VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

Ighv1-9

Gene Name Ighv1-9
Sequence Strain (Species/Organism) Mus musculus
NCBI Gene ID 668478
Genbank Accession AC073561
Taxonomy ID 10090
Chromosome No 12
Gene Starting Position 114583568
Gene Ending Position 114583861
Protein Name immunoglobulin heavy variable V1-9
Protein Note Also known as Igg2a; Gm16697
DNA Sequence
>gi|372099098:114583568-114583861 Mus musculus strain C57BL/6J chromosome 12, GRCm38 C57BL/6J
GTCTTGCACAGTAATAGATGGCAGAGTCCTCAGTTGTCAGGCTGCTGAGTTGCATGTAGGCTGTGTTGGA
GGATGTATCTGCAGTGAATGTGGCCTTGCCCTTGAACTTCTCATTGTAGTTAGTACTACCACTTCCAGGT
AAAATCTCTCCAATCCACTCAAGGCCATGTCCAGGCCTCTGCTTTACCCACTCTATCCAGTAGCCAGTGA
ATGTGTAGCCAGTAGCCTTGCAGGAAAGCTTCACTGAGGCCCCAGGCTTCATCAGCTCAGCTCCAGACTG
CTGCAGCTGAACCT
Molecule Role Vaximmutor
Related Vaccines(s) A. pleuropneumoniae DNA vaccine pcDNA-apxIA/pcDNA-apxIIA , B. abortus DNA vaccine encoding RplL and Omp16 , B. abortus subunit vaccine using L7/L12 , Brucella abortus S19 vjbR mutant vaccine , C. abortus DNA vaccine encoding DnaK , C. abortus DNA vaccine encoding MOMP , C. parvum DNA vaccine encoding CP23 , Francisella tularensis capB mutant vaccine , Francisella tularensis wbtA mutant vaccine , Herpes simplex virus type 1 DNA vaccine encoding GE , Influenza virus CTA1-3M2e-DD protein vaccine , Influenza virus DNA vaccine encoding HA from Influenza A virus (A/Hong Kong/1/68(H3N2)) , KKF24 , Leishmania donovani cen1 mutant vaccine , Leishmania infantum HSP70 II mutant vaccine , PCV2 DNA Vaccine encoding ORF2 Protein , Salmonella Typhi phoP mutant vaccine , Salmonella Typhimurium asd mutant vaccine , Salmonella Typhimurium asd/rfc mutant vaccine
References