VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

IgM

Gene Name IgM
Sequence Strain (Species/Organism) Mus musculus
NCBI Gene ID 16019
Genbank Accession AC073553
Taxonomy ID 10090
Chromosome No 12
Gene Starting Position 171229
Gene Ending Position 175133
Gene Strand (Orientation) -
Protein Name immunoglobulin heavy constant mu
Protein Note Also known as Igm; muH; Igh6; Igh-6; Igh-M; AI326478; MGC107036; MGC107507
DNA Sequence
>gi|121699722:171229-175133 Mus musculus immunoglobulin heavy chain complex (Igh) on chromosome 12
GTCATTTCACCTGCAGGTGACAGAGACAGTGTGAATTGCTGTCCACTTGTAGGGAGTAGAGGTAGAGGCA
GTGAGGACTGGTGACTCCCTGTCCCAGCCCTGTGTCCTCAGCCCCACAACCACACTACCTTGAACAGGGT
GACGGTGGTGCTGTAGAAGAGGCTCAGGAGGAAGAGGACGATGAAGGTGGAGGCAGTGGTCCACAGGTTC
TCAAAGCCTTCCTCCTCAGCATTCACCTCCCCCTCTATGAAGGGACACAGAGAGGGAGGGTCAAGCCAAG
TCTTGGGGTGACTGAGCATTTGCATAAGGGTTGGGGTGCCCTGATGGTTCTGGAGAATCTTAGCGAGTAT
TGACTGGTCCCCTAATAGCTCAAGCTAGACGGAGGCACAGAACAGGCCAAGCTGTAGGACACACTAATTT
GGAGCCTTTGTTCCAGGAGCCCTGGGGCAGCAGAGCAAGCAAGACAGATGCAATGTATGGACCTGGGTAA
AGGCAGACTCAGGAACTGTGGCAAAATGATATTGGTGTGCTCTGGACTTTCCCTGAGCAGGTGGTGCCAT
CGGTGCTGTTTAGACTGAGAATTTAGAGCAGGTCTCCCTGTCTCTTGGGCTTTAGCAATAAGAACAGGGA
TACCAGAGGTTGTCCCTCCTTACTTCCTGAAGGACTCAGGCATCTCATGACTTTCTTTGATCAGAGTTCC
CGTGCGTTGCTTGTCCTACCCCTGCCAGCAATGTTGGGTCTTGGTACCAAGAGATAAACAGACAGATACC
TGAGGGAGGCTGTGGGACCAGGGCATTTATTGGGATCTCTGATCCCTGTAAAGATGAGCCCTTGGGGATA
TCTAAAGCCTAGGCCCCAAATGGATATGAATATGAAGAATGTCCAGGATATGAGCCCAAAGAGGCAGTGT
TATTGGGTGGTGACTCCTTACAGAGGCTCCTTGATGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGGTTGGGGCATCTTTTGGACAACTGCATTATGTTTTCTGCATTT
TGAACTGGAGATCAGGGTGGGTGTGAGTGGGTTAGGCAATTTCACATTGGTCTTCTGAGGTGTTCTATTA
ATGGAGACACAGCCAAGGCTAACTTTCTGTCATGGGTGGTTAGTGGAGTATCTTCTGCCCCATGGTGTTG
AGACAGATAGGCATACTTTGTACCTGGGGTTATCTCTCCCAATCATAGAGTGGGCTCCTGAGGAGTATCA
GTGACCCAGCCTAGTGTAGGCTCTCTGAGCCGTGAGCCTTGGAGATTACAGCCCTGGTCAGAGTCCAGGT
GTATCTGTGTGCTATACCTGTTCACATGTTAGTGTACACATGTGAAGATGTTTCTGTACATGTGTGTATA
TGCATATCTTTGTATCTATATAGTTTATTTGTGTATATTTGCCTATAGTCTGTTTCTGTGTACACAGGAC
CATGCATATTGGTATCTGTTTCTGTGAGTGGTTGTGTGTCTATGCCTATTTGTCTCTGAAGGCGTTTGTA
AGTGTCCATGCATGTGTGTGCGCATGAACTCATGTGTATATATGTGTACCTTTGTCTGTGTGTCCATGAA
TACACATTCATGTATGTGTCTACACATGTGTACCTATATATCTATGTATAAATGCATGTGTGTCTATATA
TGTGCCTGAATGCTGCCTGCACCAGGTTAGGCAAGCTTTCAGCCATATATCTAGAAGTAGCTGGAGGAAT
CGCATGTTCATACTCTGTCTGTTGTAAGCCTGACTGAGTTCACACACAAGGAGGAAACTGGCAAGGTAGA
GGAAGGGCCAGGGTGGAGGCAAGTATGCAGGGTGTGTGCAGAGCAAGCAAAACACAACTGTCTCAGCAGG
CATGAGCATTGTATAATCAAAACCAGTGACGTTTGAATGGATTTTTTTTATTTCTAATTTTTATAAAATG
CAACATCTCACTCTGACATGGTTAGTTTGCATACACAGAGCAACTGGACACCCAGGGCCTGCCTGGTTGA
GCGCTAGCATGGTCAATAGCAGGTGCCGCCTGTGTCAGACATGATCAGGGAGACATTGTACAGTGTGGGT
TTACCAGTGGACTTGTCCACGGTCCTCTCGGTCACCAGGTGTGGCAGGGCCTCGTGGCCTACAACACAGG
TATAGGTCTCTCCGGAGTTCCATTCCTCCTCTGTCACAGTCAGGATGCTGTGGGTAAAGTAGAAGCCTGG
GGCCCCAGGCTCTGGCATCGGGGCACTGGTCACATACTTCTCTTGGGGCAAGAGTTGCCCTCTCTGAAGC
CACTGCACACTGATGTCTGCAGGAGAGAAGCCCTTCACCAGGCAGGTGACTGTGGCTGACTCCCTCAGGT
TCAGTTGCTCACGAGCTGGTGGCAGCAGGTACACAGCAGGTGGATGTTTGTGCACCTCTGTAAATGAAGA
CAGTAGTGAGGATAGGGTGGAAGAGGACCTGCCCTCCCTATGAGGTACAGGAAGGGTCCTGCAATTGGAG
GGGAAGGGAAGGGGGGATACCTACCATTGGGTTTTGAGATGAATTTCTTCTGTGGTGAAGGCAGATCCCT
GTGAGTCACAGTACACACAAATTCCTTCCTGTTATTCCAGTCTTCCACACAAACACTAGCCACACCCTTA
GCACTGAAGGTGCCATTGGGATGGCTTTCCATGATTTTAATTTTGGTTTCCAGTGGTTCACCACTTTGAG
AAGCCCAGGAGATATTCAGGGTTTCATAGGTTGCCAGGTTTGAGACCAGACAGGTCAGGTTAGCGGACTT
GCTGAGGAAGATGTCGGCAAAGGAGGGGGGGATGGTGAAGGTTAGGATGTCTGTGGAGGGACCTGCAGTC
AAGAGAACACTGTGTCAGGTTATGACATATCTAGTTGTGAAGTTGGAAAAAAGCTTAGTCTCCATCCCCC
AAACCTACTTAAGGGAAGATGCTGGTCCTTCCAGCTGATTCTCACCCCTCTACTGCCTATTGCTCATTCT
TGTCCTTGGCCACTCTGGGGAGCCAAAGTTCAAGGAGCAAATGACCATGTCTGGGTGGCATTGGCCATAA
TTGTAGGAGGACTTCCCTAATCTGGGAGGGCTAGGCATTGGGCTTAGCCCAGGCCACTCACTGGCAGCAC
ATGTGGAGGACACGTTCTTCAAGAAGGTGAGACCCCTGTGATCCACACGGCAGGTGTACACATTCAGGTT
CAGCCAGTCGATTTCAGAGATGGTAAGTGTGCTTATGACCTTGTAGGTTTGGGGTGTGGATCCTTTGTTC
TCGATGGTCACCGGATCTGTGGTGAAGCCAGATTCCACGAGCTTCCCATCCTTTAGCCAGGATACTGTGA
TCGGTTTTGGAGTGAAGTTCGTGGCCTCGCAGATGAGTTTAGACTTGCGTGGTGCAGGGCCAGAGAAGCC
ATCCCGTGGTGGGACGAACACATTTACATTGGGGTTCATCTCTGCGACAGCTGGAATGAAAGGTCAAGGT
GTGAGCTCAGCTTGGCCTAAGCCCCACCCCGCTGCTCCCTCTGGGCCATGCCTGGGCCTGGGCACCCCTG
CTGGGAGGGTTTGGTTCTTACCTGGAATGGGCACATGCAGATCTTTGTTTTTGCCTCCGTAGTGGATTTT
GCATACCAGGTATTCATCTGAACCTTCAAGGATGCTCTTGGGAGACAGCAACACCTGCGAGGTGGCTAGG
TACTTGCCCCCTGTCCTCAGTGTTGGGAAGGTTCTGATACCCTGGATGACTTCAGTGTTGTTCTGGTAGT
TCCAGGTGAAGGAAATGGTGCTGGGCAGGAAGTCCCGGGCCAGGCAGCCCATGGCCACCAGATTCTTATC
AGACAGGGGGCTCTCGCAGGAGACGAGGGGGAAGACATTTGGGAAGGACTGACTC
Molecule Role Vaximmutor
Related Vaccines(s) Bordetella bronchiseptica aroA mutant vaccine (strain BBS18) , Francisella tularensis capB mutant vaccine , Recombinant Aeromonas hydrophila vaccine (Aera) , Salmonella Typhimurium poxA mutant vaccine
References