VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

IgG2b

Gene Name IgG2b
Sequence Strain (Species/Organism) Mus musculus
NCBI Gene ID 16016
Genbank Accession AC160982
Taxonomy ID 10090
Chromosome No 12
Gene Starting Position 56717
Gene Ending Position 60336
Gene Strand (Orientation) -
Protein Name immunoglobulin heavy constant gamma 2B
Protein Note Also known as IgG2b; Igh-3; gamma2b
DNA Sequence
>gi|121699722:56717-60336 Mus musculus immunoglobulin heavy chain complex (Igh) on chromosome 12
CCTAGGCTCCCTGCCCAATCATGTTTCTGTAGTCAGGGGAGATCTTCTGCTTCAGCTCCACCACTGAGGA
GAAGATCCACTTTACCTGTGGGGAAGTGAGAGTCAGAGACCACACCCATGCTCAGACCCTCCAATCCTGT
GGGGAAGACAGAGGCCTGTCTCTTCTTCAATTCCTTTCATACAGGTAGGAGACTGGGTATGGGAAGTGGT
CAAAGTGGAGATATTGTGGGAGTTGAGGTGGAGATGGTATGAGATTAGCTCACAGAGTACCTTGAGTTAT
GGTGAGGCGAACATCAAGGGGATTGTGTGTTAGACAGCATGAACCTCATTAAGGCTAGTGTGGAATGCAA
GGAGGTTTGGTCTCATAAGACAGTATGAGGATCACGCAGGACAGCAGTAGAGACAGAAGGGCAGACTGTA
TGGGACAAAATGTGGAGTCACATAGAGCAATGTGGGATGGCTCAGGGAATGGAGGAAACGGTGTGTGGTA
CAGAGTGGGGACAGCAAAGTAACATCCTACTACATCAGGGGAGGAGTGAGAGGACATTTTGTGGTCAGTG
TAGCTATCACAGCAGAGGGTGGGAGACAGTGCCAACCTTGAAGAGTGTGACAGAGGCGCTGTAGCACACG
CTGAGCAGGAAGAGGCTGATGAAGATGGTGATGGTCGTCCAGAGCCCGTCCAGCTCCCCATCCTTGGCCT
CAGCACAGATATCATCCAGGTCTAGCCCTGAACAGAGAGGACAGTCAGTGTTTGTCCCAACATGGTTGAT
GCTGGGAGAGATTCCCTGTGAGGCAGACATGTCTGCATGAAGTCAGAGGAGAGATCTCCAGCCTGACTGG
GACAGCAGACCCTCCCCGGGGCCTGCTTTCCTTCCTTTCCCTCTGGGACATCAGTCTCAGCTTCCTCCAC
CTGAGTCCAATAATGCCTTGGATGGACCTCAGAGTGACCTGGATTATTCAAGTGCCCTCTATGCTTGTCT
CATCTTTCATTCCTTCAGTACAGGAGAAGGTGGAGGGTCAGCAGGGCCTGTGACCCAGGTCAACAGTGGC
TATACAGCTGGACTGACCCTTTGCTATTCTTCAGTCATCAGCAGAGCCTGTGGCTTTTCTTGCCTGAACT
TGGGAACATCCCAGTGTGAAGTGATTCAGACCATTATGGCTATGGTTTGAATTATTCATGTGGGGTTGAA
GCATGACCCCGAGGTACCAGAGATGAATCTGGCTTCAGAGGTCTTGTTTTGAGCGGAGAATGGAGTGTCC
TCAGAAGAGGAAAGGTGTGTCTGATTGTGATGGCAGAAACGTGGGCATTGAATTTTTGGCCGTGTGTATG
GTGATACATTGCTGGATGTAGGTGCTGTGCTGGGCACAGAGGAGTTGTCCCAGTGTGTTAAATGCGTTTT
GTGCTCACGAGCATGAGGATACATGTGCTATATGGACTGGATGGTGTTCAGCAGGGTCAGGATTTAGCAT
GAGTGTGGCTATCTAATAGTCCCTCCCTTGGGGCATCAAGAGCCATGTGCCTCAGCCCCAGGTGGCACAG
GCAGGAGTGAGCCATTTGTATGGGTGTGCAGACCTCGTCTGTGAAAAGCTGCCTGAGTTGAGAGTATAGA
TGACAAAGGTCTATGGAATGCCCCTGGCCATGTGTCACTCCACAATAGACTCAGAAAAACCCCTAAGTAG
AGAAATGGGGCAGGGGGACAGGAACAGCCTAAGGGAGGTGGGTTTGTGTGCTTATCCATTTGAGGCTTCC
TAGGATTATCTCTATGTCTGGCAGCTGCTGGTTCATGGGAAGGCAAGGAAAAGGCACTGCCTAAAGCCAA
GCCCCAACAGTCCAAGGCAGAATGACTCATGACCTCTGAGTCATGCAGTGCAGAAACCTCATTCTCTTCC
TATAGACAAGGCTGTCCTCCAACCCTGGCCAGACCTATCAGCCCGTGAGCTATGCTCTATACCTTGGAAA
GAACCAGGACAGTTTTACATGGTACCAGGCTTTGCTGGATGCTTTATTTATACAAGGGATGCATGGATAT
GGGTGCCAGTGTCTCTTAGGACCTGAGAGCTTTGTGGGTGCTGAGCTCATTTACCCGGAGACCGGGAGAT
GGTCTTCTTCAGGTAGTAATTTTTCAGACCCTCGTGTCTCACGTTGCATGAGAAGGAATCTGTTTTCTCC
CACTTGCTTGTTTTTATATCGAGCTTGCTGTATATGAAGTAAGAACCGTCAGAGTCCAGGACTGGTGCGG
TGTCCTTGTAGTTCTCCTCTGTATGCCCATTGCTGGTCCACTCCACACTGATGTCTCCAGGGTTGAAGCC
CACGACCAGGCAAGTGAGACTGACATCTTTCCTGGACAACTGCTCTGCTGGTGGCGGCAAGATGTATACT
TGTGGAGCTCTGACTAGCCCTGTGGGGTTAGAAACATACATAGAGGTCATGGCTGAAGTGGAAGGCTGTC
CACATAGACATTTATTCTTATGCCCATCCCAGCCCCCATGCAGTTGTCCTGCAGGTCCCACCTTTAATTT
TTGAGATGGTTCTCTCGATGGGTGATGGGAGGTCTTTGTTGTTGACCTTGCATTTGAACTCCTTGCCACT
CATCCAGTCCTGGTGCTGGATGGGGAGGGCACTGACCACCCGGATAGTACTGTTGTAATCCTCTCTATGG
GTTTGTGTCTGAGCTGTGTGTACTTCCACGTTGTTCACAAACCAGCTGATCCGGACGTCTGGGTCATCCT
CGCTCACATCCACCACCACACACGTGACCTTGGGTGTCAGGGAGATCATGAGTACATCCTTGATATTTGG
AGGGAAGATGAAGACGGATGGTCCACCCTCGAGGTTAGGAGCTGATGAGAAGAGATGGAAATGGATTTGT
ACATGGCTTATCCTCCATTACAGGGATTTTTACAGCACTTACCATTCTCCTGGGAGTGGAGCTCTGGTAG
TGACTTACCTGGGCATTTGTGACACTCCTTGCATGGAGGACAGGGGTTGATTGTTGAAATGGGCCCGCTG
GGCTCTGCAGAGAGAAGGCTGGATGTTACTGGTTTTTGAAGGAGAGAAGCACCAAACCAGAGAGAGGAAA
GTTTGTCCCTGGTATGGGCTTAGTCCAGGATGATCCTGGAAATGACAAGCACACCTATCCCAGAGGATCA
TGTCCTTGAGTGTAGGTGGTCATAGCTAGATGTTCCCAGGAGGGAGGCAGAGACAGTATCTCCCTCTTCC
CTGGGCTAAGGTCACCTCCTTGGTGATGGATCCCAGCCTGGCTGGTTTAGATAGGCTAATACCTTTGCCT
CAACTCTGGTGAATCCCTCCTCCCCTGAATGTCCTCTCACCAAGTTTTTTGTCCACCGTGGTGCTGCTGG
CTGGGTGAGCAACGCTGCAGGTGACGGTCTGACTTGGCCAGGTGCTGGAGGGGACAGTCACTGAGCTGCT
CATAGTGTAGAGTCCAGACTGCAGGAGAGCTGGGAAGGTGTGCACACTGCTGGACAGGGATCCAGAGTTC
CAAGTCACAGTCACTGACTCAGGGAAGTAGCCCTTGACCAGGCATCCCAGAGTCACAGAGGAACCAGTTG
TATCTCCACACCCAGGGGCCAGTGGATAGACTGATGGGGGTGTTGTTTTG
Molecule Role Vaximmutor
Related Vaccines(s) Salmonella Typhi phoP mutant vaccine
References