VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Cov19VaxKB
Vaccine Mechanisms
VaximmutorDB
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign2
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

Human parainfluenza virus 1 genome

Gene Name Human parainfluenza virus 1 genome
Sequence Strain (Species/Organism) Human parainfluenza virus 1
NCBI Nucleotide GI 19718363
NCBI Protein GI 19718364
Protein Accession NP_604433.1
Taxonomy ID 12730
Gene Strand (Orientation) ?
Protein Name nucleoprotein
Protein Note nucleocapsid protein
DNA Sequence
>gi|19718363|ref|NC_003461.1| Human parainfluenza virus 1, complete genome
ACCAAACAAGAGGAAAAACTTGTTTGGAATATATAATAATATTAAATAGTATTTTAGGGTTAAAGTAATA
CTTTAAAGGGACAAGTCACAGACATTTGATCTTAGTATAAATTTTTATAATGGCCGGGCTACTAAGTACT
TTTGACACATTTAGTTCCAGGAGAAGTGAGAGCATCAATAAGTCTGGCGGAGGAGCAATTATACCTGGTC
AAAGAAGTACCGTTTCTGTCTTCACATTAGGCCCGAGTGTGACAGATGATGCAGATAAATTATTAATAGC
AACCACTTTCTTAGCCCACTCATTGGACACAGATAAACAACACTCTCAAAGAGGAGGATTTTTAGTATCA
CTCCTTGCAATGGCCTACAGTAGTCCGGAGTTATATCTCACTACAAACGGTGTCAATGCTGATGTCAAGT
ATGTGATATACAATATAGAGAGAGATCCTAAAAGAACAAAAACAGATGGGTTCATTGTCAAAACAAGAGA
CATGGAGTATGAAAGAACAACAGAGTGGTTGTTTGGACCTATGATCAACAAGAACCCATTGTTCCAAGGG
CAAAGAGAGAATGCGGATCTAGAGGCATTGCTTCAGACATATGGATATCCTGCATGTCTCGGAGCTATAA
TAGTTCAAGTTTGGATAGTGTTGGTTAAAGCCATAACAAGTAGTGCTGGTCTAAGAAAAGGATTCTTCAA
TAGATTAGAAGCATTCAGACAGGATGGAACCGTTAAAAGTGCCCTGGTCTTCACAGGAGACACAGTTGAA
GGTATTGGTGCAGTGATGAGGTCACAACAAAGCTTAGTATCTCTTATGGTAGAAACTCTGGTGACTATGA
ACACATCCAGGTCAGATTTAACTACATTAGAGAAGAACATTCAGATTGTAGGAAATTACATAAGAGATGC
AGGATTAGCATCTTTCATGAACACCATCAAGTATGGTGTAGAAACGAAGATGGCCGCCCTGACACTATCA
AATCTGAGACCAGATATAAACAAATTGAGAAGCCTTGTTGATATCTATCTATCAAAGGGAGCCCGAGCCC
CTTTTATATGTATACTCAGAGACCCAGTTCATGGAGACTTTGCCCCTGGAAACTATCCAGCACTGTGGAG
CTACGCAATGGGCGTTGCTGTGGTACAAAACAAAGCTATGCAACAGTATGTAACTGGAAGAACATATTTG
GACATGGAAATGTTCCTACTTGGACAAGCTGTAGCTAAAGATGCTGATTCCAAAATCAGCAGTGCTCTGG
AGGAAGAACTAGGTGTGACAGATACAGCAAAAGAGAGACTAAGACACCATCTGACAAACCTTTCAGGAGG
GGATGGTGCGTACCACAAGCCTACAGGTGGTGGAGCTATAGAAGTGGCAATTGATCATACAGACATAACA
TTTGGAGTCGAGGACACTGCTGATCGGGACAACAAGAACTGGACAAATGACAGCAATGAAAGATGGATGA
ATCACTCGATCAGCAACCACACAATCACGATTCGTGGTGCAGAAGAACTTGAAGAAGAGACAAATGATGA
AGACATCACTGATATAGAAAACAAGATTGCACGAAGGCTGGCCGACAGAAAACAGAGACTAAGCCAGGCA
AACAATAAACGAGACACCAGCAGTGATGCTGACTATGAGAATGATGATGATGCTACAGCGGCTGCAGGGA
TAGGAGGAATTTAACAGGATACTTGGACAATAGAAGCCAGATCAAAAGTAAGAAAAACTTAGGGTGAATG
ACAATTCACAGATCAGCTCAACCAGACACCACCAGCATACACGAAACCAACCTTCACAGTGGATACCTCA
GCATCCAAAACTCTCCTTCCCGAATGGATCAGGATGCCTTCTTTTTTGAGAGGGATCCTGAAGCCGAAGG
AGAGGCACCACGAAAACAAGAATCACTCTCAGATGTCATCGGACTCCTTGACGTCGTCTTATCCTACAAG
CCCACAGAAATTGGAGAAGACAGAAGCTGGCTCCATGGTATCATCGACAACCCAAAAGAAAACAAGCCAT
CATGCAAAGCCGACGATAACAACAAAGACAGAGCAATCTCAACGTCGACCCAAGATCATAGATCAAGTGA
GGGGAGTGGAATCTCTAGGAGAACAAGTGAGTCAAAAACAGAGACACATGCTAGAATCCTTGATCAACAA
GGTATACACAGGGCCTCTAGGCGAGGAACTAGTCCAAACCCTCTACCTGAGAATATGGGCAATGAAAGAA
ACACCAGAATCGACGAAGATTCTCCAAATGAGAGAAGACATCAGAGATCAGTACTTACGGATGAAGACAG
AAAGATGGCTGAGAACTCTAATAAGAGGGAAGAAGACCAAGTTGAGGGATTTCCAGAAGAGGTACGAAGA
AGTACACCCTTATCTGATGATGGAGAGGGTAGAACAAATAATAATGGAAGAAGCATGGAAACTAGCAGCA
CACATAGTACAAGAATAACTGATGTCATTACCAACCCAAGTCCAGAGCTTGAAGATGCCGTTCTACAAAG
GAACAAAAGACGGCCGACGACCATCAAGCGTAACCAAACAAGATCAGAGAGAACACAGAGTTCAGAACTC
CACAAATCAACAAGTGAAAATAGCTCCAACCTCGAAGACCACAACACCAAAACCAGCCCAAAAGTTCCAC
CGTCAAAGAACGAAGAGTCAGCAGCCACTCCAAAGAACAACCACAACCACAGAAAAACAAGATACACAAC
AAACAATGCAAACAACAACACAAAAAGTCCACCAACTCCCGAACACGACGCAACCGCAAATGAAGAGGAA
ACCAGCAACACATCGGTCGATGAGATGGCCAAGTTATTAGTAAGTCTTGGTGTAATGAAATCACAACATG
AATTTGAATTATCTAGGAGTGCAAGTCATGTATTTGCTAAGCGCATGTTAAAATCTGCAAATTACAAAGA
AATGACATTTAATCTCTGTGGTATGCTTATATCAGTTGAAAAATCACTTGAGAATAAAGTAGAAGAAAAT
AGAACATTACTTAAACAAATTCAAGAGGAAATAAATTCATCCAGGGATCTTCACAAACGGTTCTCGGAAT
ACCAAAAAGAACAGAACTCACTCATGATGGCCAATCTATCCACACTCCATATAATTACAGATAGAGGCGG
GAAAACGGGAAATCCCAGTGATACTACAAGGTCACCATCAGTCTTCACAAAAGGGAAAGACAATAAGGTC
AAAAAGACAAGGTTTGACCCCTCTATGGAAGCTCTAGGAGGTCAAGAGTTCAAGCCTGACTTGATAAGAG
AGGATGAACTGAGAGATGACATCAAAAATCCGGTACTAGAAGAAAACAACAATGAGCCTCAAGCATCCAA
TGCATCACGCCTGATTCCGTCCACTGAAAAACACACTCTGCACTCACTCAAACTAGTTATCGAAAACAGT
CCTCTAAGCAGAGTAGAGAAGAAGGCTTACATCAAATCCCTTTATAAGTGTCGGACAAACCAAGAGGTTA
AAAATGTAATGGAGCTATTCGAGGAAGACATAGATTCACTAACTAACTAAACATGAATCTACAATTTCAA
CCAGCAATCAAAATCAATATCCAGAGCCAACTCAAAAAGCTCCCTCAAAACAATTAAGAAAAACTTAGGG
TCAAAGAAATTTTGCCCGGAGAAAGGAAATGGCTGAAACATACAGGTTCCCCAGATTCTCACACGAAGAA
AATGGGACAGTAGAACCTCTCCCTCTCAAAACAGGTCCTGACAAAAAAGCAATCCCTCACATCAGAATAG
TCAAGGTAGGAGATCCTCCAAAACATGGAGTCAGGTATCTTGATGTGCTACTATTGGGATTCTTTGAAAC
ACCTAAGCAAGGACCTCTATCTGGCAGCATATCTGATCTCACAGAATCAACCAGTTATTCAATCTGTGGA
TCCGGATCCTTACCAATTGGCATAGCCAAGTATTACGGCACAGATCAAGAATTATTAAAAGCCTGCATTG
ACCTCAAAATAACTGTACGAAGAACAGTTAGATCTGGAGAAATGATAGTATACATGGTAGATTCGATCCA
TGCTCCTCTACTACCATGGTCCAGCCGACTGAGACAAGGGATGATATATAATGCCAATAAAGTAGCTCTA
GCACCTCAATGTCTCCCAGTCGACAAAGACATCAGATTCAGGGTTGTATTTGTCAATGGAACATCACTAG
GTACAATTACAATTGCTAAGGTCCCAAAAACTCTTGCAGATCTTGCATTACCGAACTCAATATCAGTGAA
TCTGCTGGTTACACTTAGGGCAGGAGTATCAACGGAACAAAAAGGAATCCTCCCCGTTCTAGACGATGAT
GGAGAAAAGAAGCTCAACTTCATGGTACACCTAGGAATCATAAGAAGAAAAGTTGGGAAGATATATTCAG
TTGAATACTGCAAAAATAAAATTGAGAAGATGAAGCTAATATTCTCTCTCGGGCTTGTAGGTGGAATAAG
TTTCCATGTACATGCAACAGGCACATTATCCAAAACTCTAATGAGCCAACTTGCATGGAAAAAAGCAGTT
TGCTATCCTTTAATGGATGTAAATCCACATATGAATCTAGTCATCTGGGCAGCTTCAGTAGAAATCACAA
GTGTCGATGCTGTGTTCCAACCTGCAATTCCGAAAGAATTTCGCTATTACCCAAATGTTGTTGCAAAAAG
CATCGGGAAAATCAGGAGGATATAAGTCTACACTCCTCAATAATGACACCCATTAGCTCTAAATCGTACC
ATTAATCAAATACAGATCAATTCGATACAATCAGTTCAAATAAGAAAAACGTAGGGACAAAGTCCTCTAC
CAACATCAAGGAAGACAAGAGTCTCAAAAAGCTCAGCCTAAGCAGAGAGAAAAACAACAACACAAAGAAA
GAAAAGGACAAGATCACAAACAAGAACAAAAGCAAAAACAAAAACAAGAACAAAAAAGGGAAGAAAAACA
AAAGTATACACAAAAACCAAAAAAGAAAAAAGGCCAGAGACAAAAACGGAGGCAAGAACAAAAATTTAAA
CAAAAACAGAATTTAAATTCATAATAAACACCAAGATAGAGACAAAAATGCAAAAATCAGAGATCCTCTT
CTTAGTATACTCAAGCTTGCTATTATCTTCATCATTATGTCAAATTCCGGTAGAAAAACTTTCAAATGTA
GGGGTTATAATCAATGAGGGCAAATTACTTAAAATAGCAGGATCTTATGAATCTAGATACATAGTGTTAA
GCTTGGTACCTTCAATTGACCTACAAGATGGATGTGGAACAACTCAAATTATTCAATACAAGAATTTATT
AAATAGACTTCTAATTCCTCTGAAGGATGCCTTGGATCTTCAGGAATCCCTGATAACAATAACTAATGAC
ACCACTGTGACAAATGATAATCCACAAACTAGATTCTTTGGTGCTGTCATTGGTACCATAGCACTAGGAG
TAGCCACAGCTGCTCAAATAACTGCGGGCATTGCATTAGCTGAAGCACGAGAAGCCAGGAAGGACATAGC
ACTAATAAAAGATTCCATAGTCAAGACACACAATTCTGTAGAACTCATTCAAAGAGGTATAGGAGAACAG
ATAATTGCATTAAAGACATTACAAGATTTTGTAAATGACGAGATAAGACCTGCAATAGGAGAACTAAGGT
GTGAGACTACGGCATTGAAACTAGGGATCAAGCTCACCCAACACTACTCTGAATTAGCAACAGCATTCAG
CTCCAATCTTGGGACTATAGGAGAAAAAAGTCTTACCTTGCAGGCATTATCATCTCTCTACTCTGCTAAT
ATAACAGAAATTCTAAGTACAACTAAAAAGGATAAATCAGATATATATGACATCATTTACACTGAACAGG
TTAAGGGAACTGTGATAGATGTTGATTTGGAAAAATACATGGTTACCCTCTTAGTTAAAATACCAATTTT
ATCAGAAATACCAGGCGTGTTGATATACAGAGCTTCATCTATATCTTATAATATTGAAGGAGAAGAATGG
CATGTCGCAATCCCAAATTACATAATCAATAAGGCATCATCCTTAGGAGGTGCAGATGTCACAAACTGTA
TAGAATCAAAATTGGCATATATATGTCCTAGAGATCCTACACAATTAATACCTGATAACCAACAGAAGTG
TATACTCGGGGATGTATCAAAGTGCCCTGTGACTAAAGTAATAAACAATCTAGTACCAAAGTTCGCATTC
ATCAATGGTGGTGTAGTGGCTAATTGCATTGCATCCACATGTACATGCGGGACAAACAGAATACCAGTGA
ATCAAGATCGCTCAAGAGGAGTTACATTCTTGACCTATACCAATTGCGGTTTAATAGGTATAAATGGAAT
AGAACTATATGCCAATAAAAGGGGACGAGACACTACTTGGGGGAATCAAATCATCAAAGTGGGTCCAGCA
GTCTCCATTAGACCTGTAGACATTTCTTTAAATCTTGCATCTGCCACAAATTTCCTAGAGGAATCCAAGA
CAGAGCTCATGAAGGCAAGGGCAATCATATCAGCAGTTGGAGGATGGCACAACACAGAGAGTACTCAGAT
AATCATGATAATAATTGTGTGCATACTTATAATAATCATATGTGGTATATTATACTATCTATACAGGGTT
AGAAGACTATTAGTAATGATTAATTCAACTCATAATTCACCTGTTAATGCTTATACTCTGGAGTCAAGAA
TGAGAAATCCCTACATGGGTAACAACTCCAATTAAAAAATCAGATCAAGTACATTGTAGCATACATACAA
CAATCAAATCTATCCACAACTTCACCAATCAGGTGTACAACAAGTAAGAAAAACTTAGGGTTAAAGACAA
TCCAGTCAACCTATAAGGCAACAGCATCCGATTATACAAACGATGGCTGAAAAAGGGAAAACAAATAGTT
CATATTGGTCTACAACCCGAAATGACAATTCCACGGTAAACACACACATTAATACACCAGCAGGAAGGAC
ACACATCTGGCTACTGATTGCAACAACAATGCATACAGTATTGTCCTTCATTATCATGATCCTATGCATT
GACCTAATTATAAAACAAGACACTTGTATGAAGACAAACATCATGACAGTATCCTCCATGAACGAAAGTG
CCAAAATAATCAAAGAGACAATCACAGAATTAATCAGACAAGAAGTAATATCAAGGACCATAAACATACA
AAGTTCAGTACAAAGCGGGATCCCAATATTGTTAAACAAGCAAAGCAGAGATCTCACACAATTAATAGAG
AAGTCATGCAACAGACAGGAATTGGCTCAGATATGCGAAAACACCATTGCTATTCACCATGCAGACGGCA
TATCTCCTCTGGACCCACACGATTTCTGGAGATGTCCCGTAGGGGAACCCCTACTGAGCAACAACCCCAA
TATCTCATTATTACCTGGACCAAGTCTACTTTCTGGATCCACCACAATTTCAGGATGTGTTAGACTACCT
TCATTATCAATTGGTGATGCAATATATGCGTATTCATCAAACTTAATCACTCAAGGATGTGCAGATATAG
GGAAGTCATATCAGGTTTTACAATTAGGTTACATATCCTTAAATTCAGATATGTATCCTGATTTAAACCC
GGTAATTTCTCATACCTATGACATCAACGACAACAGGAAATCATGTTCTGTAATAGCTGCAGGAACAAGG
GGTTATCAGTTATGCTCCTTGCCCACTGTGAATGAGACTACAGACTACTCGAGTGAAGGTATAGAAGATT
TAGTATTTGACATATTAGATCTCAAGGGAAAGACCAAATCTCATCGATACAAAAATGAAGATATAACTTT
TGACCATCCTTTTTCTGCAATGTATCCGAGTGTAGGAAGTGGGATAAAAATTGAAAATACACTCATTTTC
CTAGGGTACGGTGGCTTAACAACTCCGCTCCAAGGCGACACTAAGTGTGTGATAAACAGATGTACCAATG
TTAATCAGAGTGTTTGCAATGATGCTCTTAAGATAACTTGGCTAAAGAAAAGACAAGTTGTCAATGTCTT
AATTCGTATCAATAATTATTTATCTGATAGGCCAAAGATTGTTGTCGAGACAATTCCAATAACTCAAAAT
TACTTAGGTGCCGAAGGTAGGCTACTTAAACTAGGTAAAAAGATCTACATATATACTAGATCTTCAGGTT
GGCACTCCAACCTGCAAATAGGATCATTAGATATCAACAACCCCATGACCATTAAATGGGCGCCTCATGA
AGTCCTGTCTCGACCAGGAAACCAAGACTGCAACTGGTACAACAGATGTCCGAGAGAATGCATATCAGGT
GTATATACTGATGCATATCCACTATCTCCTGATGCAGTCAATGTTGCTACAACCACACTGTACGCAAACA
CATCACGTGTTAATCCCACCATAATGTACTCAAATACCTCAGAAATTATCAACATGCTAAGACTCAAGAA
TGTACAACTAGAGGCAGCATACACTACTACATCATGTATCACTCATTTCGGGAAGGGCTACTGCTTCCAC
ATTGTTGAAATCAACCAAGCCAGCCTTAATACCTTACAACCTATGTTGTTCAAGACAAGTATCCCTAAAA
TATGTAAAATCACATCTTGAGCAGATCAAGACCCAACACTATATCAATTATGTGAAAACCAGATATGATG
TATAAAAATTTAAAAACAAAGCATGAATAGACATTTATATGACAAATAGAATAAGAAAAACTTAGGGTTA
ATGCCTGCCTATTTGTCAAATATGGATAAACAGGAGTCAACTCAGAATTCCTCAGACATCTTATATCCAG
AATGTCACTTGAACTCTCCGATTGTAAAAAGCAAGATTGCTCAACTTCACGTTTTGCTAGATATCAATCA
ACCCTATGATTTAAAAGATAACAGTATAATAAATATCACCAAATACAAAATCAGAAATGGAGGTTTATCG
CCCCGGCAGATCAAAATCAGATCGCTAGGCAAAATCCTTAAACAAGAAATTAAGGATATTGATCGTTACA
CTTTTGAACCTTATCCGATTTTCTCATTAGAGTTACTCAGACTGGATATCCCAGAAATATGTGACAAAAT
AAGATCCATTTTTTCAGTCTCTGATAGATTAATAAGAGAACTATCATCTGGATTTCAAGAATTGTGGTTA
AATATTCTTAGACAATTAGGCTGTGTTGAAGGGAAAGAGGGATTTGACTCATTAAAGGATGTAGATATCA
TCCCAGATATAACTGATAAATATAATAAAAACACATGGTATCGCCCATTCTTAACATGGTTTAGCATCAA
ATATGATATGAGATGGATGCAAAAGAATAAGTCGGGGAACCATTTAGATGTCTCAAATTCTCACAATTTT
CTTGACTGTAAATCATATATTTTGATTATATATAGAGATTTAGTGATAATAATAAATAAATTAAAATTAA
CCGGTTATGTCCTTACACCTGAATTAGTATTAATGTATTGTGATGTTGTCGAAGGAAGATGGAATATGTC
TTCAGCTGGACGACTCGATAAAAGGTCATCAAAAATAACATGTAAGGGGGAAGAATTATGGGAGCTTATC
GACTCTTTATTTCCCAATCTTGGTGAGGATGTATATAATATTATATCACTACTAGAACCTTTATCACTTG
CTTTAATACAGTTGGATGACCCTGTAACTAATTTAAAAGGAGCTTTCATGAGACATGTTTTGACTGAGCT
ACATACAATTTTAATAAAAGATAATATATACACAGATTCAGAAGCAGACAGCATAATGGAATCATTGATA
AAGATTTTCAGAGAGACATCAATTGATGAAAAAGCAGAAATTTTCTCCTTTTTTAGAACGTTTGGACATC
CTAGCTTAGAAGCAATAACTGCTGCCGATAAAGTAAGGACACATATGTATTCCTCCAAAAAAATCATACT
AAAGACACTATATGAGTGTCATGCAATCTTCTGTGCAATTATAATAAACGGATATAGAGAAAGACACGGT
GGTCAATGGCCGCCATGCGAATTCCCCAATCATGTATGTCTTGAACTCAAGAATGCACAAGGATCCAACT
CTGCAATTTCGTATGAATGTGCCGTAGACAATTATAGTAGTTTTATAGGATTTAAATTTTTAAAATTTAT
TGAGCCTCAATTAGATGAAGATTTGACAATTTATATGAAGGATAAGGCTCTATCACCTAGGAAAGCAGCA
TGGGATTCAGTATATCCCGACAGTAATTTATATTACAAAGTCCCTGAATCAGAAGAGACTCGTAGGTTAA
TCGAGGTTTTTATAAATGATAATAATTTTAACCCTGCGGATATTATTAATTATGTAGAGTCAGGAGAATG
GTTAAATGACGATAGCTTCAACATATCTTACAGTCTCAAAGAAAAAGAAATTAAACAAGAGGGTCGACTC
TTTGCCAAGATGACATATAAGATGAGAGCAGTCCAGGTATTAGCAGAAACACTACTAGCAAAAGGAGTAG
GTGAGTTATTCAGTGAAAATGGGATGGTAAAGGGAGAAATTGACCTACTAAAGAGACTGACTACATTATC
TGTCTCAGGTGTTCCAAGATCCAACTCAGTTTACAATAATCCCATATTACATGAGAAATTGATCAAAAAT
ATGAATAAGTGCAATTCAAATGGGTATTGGGATGAAAGAAAGAAATCTAAAAATGAATTCAAAGCTGCAG
ACTCATCAACCGAGGGGTATGAGACTCTGAGCTGTTTTTTAACCACCGATTTGAAAAAATACTGTCTCAA
CTGGAGATTTGAAAGTACAGCGTTGTTCGGTCAAAGATGTAATGAGATATTCGGGTTTAAAACTTTCTTT
AACTGGATGCACCCTATTCTAGAAAAAAGTACAATTTATGTAGGAGATCCTTACTGTCCAGTACCTGATA
GAATGCACAAAGAACTCCAAGATCATGATGATACCGGAATCTTTATCCATAATCCAAGAGGGGGAATAGA
GGGTTATTGCCAGAAATTATGGACACTAATCTCTATTAGTGCAATCCATCTTGCAGCTGTTAAAGTTGGT
GTCAGAGTGTCAGCAATGGTACAAGGAGACAATCAAGCTATAGCAGTGACATCCAGAGTTCCTGTCACAC
AAACCTATAAGCAAAAAAAGACTCACGTCTATGAAGAAATCACAAGATATTTCGGTGCCTTGAGAGAAGT
TATGTTTGATATTGGACATGAATTAAAATTAAATGAGACCATTATAAGTAGCAAAATGTTTGTATACAGC
AAACGGATATATTATGATGGGAAAATCCTCCCACAGTGCCTCAAAGCTTTAACAAGATGTGTATTTTGGT
CAGAGACTCTTGTAGATGAAAACAGGTCAGCATGCTCAAACATTGCAACATCTATAGCCAAAGCTATTGA
GAATGGATATTCACCTATCTTAGGCTATTGTATTGCTCTTTTTAAAACTTGCCAACAGGTATGTATATCA
TTAGGAATGACCATTAATCCTACTATTACGTCAACTATCAAAGATCAATATTTTAAAGGGAAAAATTGGT
TAAGATGTGCAATATTGATCCCAGCTAACATAGGAGGGTTCAACTATATGTCTACAGCTAGATGTTTTGT
CAGAAATATAGGTGATCCAGCAGTTGCAGCTCTAGCAGACTTAAAGAGATTCATCAAAGCAGGTCTGTTA
GATAAACAGGTATTATATCGTGTGATGAATCAAGAACCAGGAGACTCAAGCTTCTTAGATTGGGCATCAG
ACCCTTATTCATGCAATCTCCCACACTCACAAAGTATAACAACTATAATCAAAAATGTAACAGCTAGATC
AGTATTGCAGGAATCACCTAATCCTCTCCTATCAGGTCTCTTTTCAGAATCAAGTAGTGAAGAAGATCTC
AACTTAGCATCATTTTTGATGGATAGGAAAGCCATATTGCCCAGAGTAGCTCACGAGATCTTAGATAACT
CACTTACAGGTGTAAGAGAAGCTATAGCCGGGATGCTTGATACAACGAAATCTCTAGTAAGAGCTAGTGT
CAGGAGAGGAGGATTATCATATAGTATCTTAAGAAGACTTATAAATTATGATCTATTACAATATGAGACC
TTAACAAGGACACTCAGAAAACCGGTTAAGGATAATATAGAATATGAGTATATGTGTTCAGTAGAATTGG
CAATAGGATTGAGGCAAAAAATGTGGTTTCATCTAACTTATGGAAGACCAATCCACGGTTTAGAAACTCC
AGACCCGTTAGAATTATTAAGAGGATCATTTATTGAAGGCTCAGAAATATGTAAATTTTGTAGATCAGAA
GGGAATAACCCTATGTATACTTGGTTCTATCTTCCTGACAACATCGACTTAGATACACTTAGCAATGGAA
GTCCTGCCATACGTATCCCTTATTTTGGTTCTGCTACTGATGAAAGATCAGAGGCTCAACTAGGTTATGT
TAAGAACTTAAGCAAGCCGGCAAAAGCAGCAATAAGAATCGCAATGGTTTACACTTGGGCTTATGGAACT
GATGAAATATCATGGATGGAAGCAGCACTTATAGCTCAAACCAGGGCTAACTTAAGTTTAGAGAATTTGA
AGTTACTCACCCCTGTATCGACTTCTACAAATTTGTCCCACAGATTGAGAGATACTGCTACACAGATGAA
ATTTTCAAGTGCTACTTTAGTTCGAGCGAGTCGATTTATTACCATATCTAATGATAATATGGCATTAAAA
GAGGCAGGAGAGTCTAAAGATACTAATTTAGTTTATCAACAAATTATGTTAACCGGATTGAGCTTATTTG
AATTCAATATGAGGTATAAACAAGGATCATTATCTAAACCTATGATATTACACTTACATTTGAATAATAA
ATGCTGTATCATAGAATCTCCTCAAGAATTGAATATTCCTCCTAGATCTACATTGGACTTAGAGATCACT
CAGGAAAATAACAAGTTAATCTATGATCCTGATCCTCTCAAGGACATAGATCTAGAGTTATTTAGTAAGG
TTAGGGATGTAGTACACACAATTGATATGAATTATTGGTCTGATGATGAAATAATTAGAGCAACTAGTAT
ATGTACAGCTATGACTATTGCAGACACAATGTCTCAATTAGATAGAGACAATCTTAAAGAAATGATAGCA
CTGATAAATGATGATGATATAAATAGTTTAATCACCGAATTTATGGTTATTGATATACCCTTATTTTGTT
CCACTTTCGGGGGTATTCTAATCAATCAATTTGCATATTCACTTTACGGGTTAAACGTCAGAGGGAGGGA
TGAAATATGGGGATATGTGATACGCATAATTAAAGACACATCACATGCAGTCCTAAAAGTACTGTCCAAT
GCATTATCACATCCTAAAATATTCAAACGATTCTGGGATGCAGGAGTTGTAGAGCCTGTTTATGGACCTA
ACTTGTCCAATCAAGACAAGATACTGTTAGCCATTTCAGTATGTGAATACTCTGTTGACCTCTTCATGCG
TGATTGGCAAGAGGGCATACCGCTTGAAATATTTATTTGTGATAACGACCCAAATATAGCAGAAATGAGA
AAACTTTCATTTTTAGCTAGACATCTAGCATACTTGTGTAGTTTGGCAGAGATAGCTAAAGAGGGACCAA
AATTGGAATCTATGACATCTCTCGAACGACTCGAATCATTGAAAGAGTATCTAGAACTTACTTTTTTAGA
CGATCCTATATTAAGATATAGTCAATTGACAGGCTTAGTTATTAAGATATTCCCTTCAACGTTAACTTAC
ATCAGGAAATCTTCAATTAAGGTGTTGAGAGTAAGAGGTATAGGGATACCAGAAGTCTTAGAGGACTGGG
ATCCTGATGCCGATAGTATGCTACTAGATAATATAACTGCTGAGGTTCAACACAATATACCTTTAAAGAA
GAACGAAAGAACTCCCTTCTGGGGGTTAAGGGTATCAAAATCACAAGTTCTGCGACTTAGAGGTTATGAA
GAGATAAAAAGGGAAGAAAGAGGAAGATCAGGTGTAGGATTAACTCTACCTTTTGATGGGCGATATTTAT
CACACCAATTGAGACTTTTCGGGATTAATAGCACCAGTTGTTTGAAAGCATTGGAACTTACCTATTTACT
GAATCCTCTAGTCAATAAGGATAAAGATAGATTATATCTCGGAGAAGGTGCAGGTGCAATGCTGTCTTGT
TATGATGCTACATTAGGACCCTGCATGAACTATTATAATTCAGGTGTTAATTCTTGTGATCTCAACGGAC
AAAGAGAATTAAATATTTATCCTTCAGAAGTGGCACTGGTAGGGAAGAAATTGAATAATGTCACGAGTTT
ATGTCAAAGAGTTAAGGTTTTATTCAATGGGAATCCTGGATCAACTTGGATAGGGAATGATGAATGTGAA
ACACTAATCTGGAATGAATTACAGAATAATTCAATAGGGTTTATTCATTGTGACATGGAAGGTGGAGAAC
ACAAATGTGATCAGGTGGTCTTACATGAACATTATAGTGTGATCAGGATTGCATACCTTGTTGGGGATAA
GGACGTTATCTTAGTAAGCAAAATTGCACCAAGATTAGGTACAGACTGGACAAAACAATTAAGTTTGTAT
TTAAGATACTGGAGAGATGTCAGCTTAATAGTGTTGAAAACATCTAACCCAGCCTCTACAGAAATGTATC
TGATATCAAAAGATCCTAAATCTGATATTATAGAGGATAGTAATACAGTATTGGCAAACCTTCTTCCATT
ATCTAAAGAGGATAGTATTAAGATAGAAAAATGGATTCTAGTTGAGAAAGCCAAAGTTCATGATTGGATA
GTTAGAGAATTAAAGGAAGGGAGTGCATCGTCAGGTATGCTAAGACCTTACCATCAAGCATTACAAATCT
TCGGATTTGAGCCTAATTTAAACAAATTATGTAGAGATTTCTTATCTACACTAAATATAGTAGACACAAA
AAATTGTATTATCACATTTGATAGAGTATTAAGAGATACAATCTTTGAGTGGACTCGGATAAAAGACGCA
GATAAGAAGCTAAGACTTACAGGTAAATATGATCTATATCCTCTTAGAGATTCAGGTAAGTTAAAAGTTA
TTTCTAGAAGGCTTGTAATATCTTGGATAGCATTGTCTATGTCTACAAGACTAGTAACAGGGTCATTTCC
AGACATTAAATTTGAATCAAGACTCCAATTAGGTATAGTATCAATATCCTCTCGTGAAATCAAAAATCTT
AGGGTTATATCAAAGATTGTCATTGACAAATTTGAAGATATTATACATAGTGTGACCTATAGGTTCTTGA
CTAAAGAAATAAAAATATTGATGAAAATTTTGGGAGCAGTCAAATTATTTGGGGCAAGACAGAGCACATC
TGCTGATATCACTAATATCGATACATCGGACTCCATACAATGATCTTATATCTTCTCATCTTTATTATCT
AATTTGTTTAAAGAGATGAGTTAACAAGATAAGAAATCCCTTTAACTGACTCATAAAAACATAGTAAGAA
AAACTTACAACAGACAAGAGTATTAATAATATATCGATATTTCTTAAACTCTTGTCTGGT
Molecule Role Other
References