VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

hfq

Gene Name hfq
Sequence Strain (Species/Organism) Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
NCBI Gene ID 1255887
NCBI Protein GI 16767607
Locus Tag STM4361
Genbank Accession AE006468
Protein Accession NP_463222
3D structure: PDB ID 2YLB
Taxonomy ID 700720
Gene Starting Position 4604574
Gene Ending Position 4604882
Gene Strand (Orientation) +
Protein Name RNA-binding protein Hfq
Protein pI 7.9
Protein Weight 10240.49
Protein Length 102
Protein Note Stimulates the elongation of poly(A) tails
DNA Sequence
>gi|16763390:4604574-4604882 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 chromosome, complete genome
AATGGCTAAGGGGCAATCTTTACAAGATCCGTTCCTGAACGCATTGCGTCGGGAACGTGTTCCAGTTTCT
ATTTATTTGGTGAATGGTATTAAGCTGCAAGGTCAAATCGAGTCCTTTGATCAGTTCGTGATCCTGTTGA
AGAACACGGTCAGCCAGATGGTTTATAAGCACGCGATTTCTACTGTTGTCCCGTCTCGCCCGGTTTCCCA
TCACAGCAACAATGCCGGTGGCGGCGCCAGCAATAACTACCATCACGGTAGCAACGCGCAGGGGTCTACT
GCGCAACAGGACAGCGAAGAGACTGAATA
Protein Sequence
>gi|16767607|ref|NP_463222.1| RNA-binding protein Hfq [Salmonella enterica subsp. enterica serovar Typhimurium str. LT2]
MAKGQSLQDPFLNALRRERVPVSIYLVNGIKLQGQIESFDQFVILLKNTVSQMVYKHAISTVVPSRPVSH
HSNNAGGGASNNYHHGSNAQGSTAQQDSEETE
Molecule Role Virmugen
Molecule Role Annotation Oral immunization with the Salmonella hfq deletion mutant efficiently protects mice against subsequent oral challenge with virulent strain of Salmonella Typhimurium (Allam et al., 2011).
Related Vaccines(s) Salmonella Typhimurium hfq mutant vaccine
References