VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

crp

Gene Name crp
Sequence Strain (Species/Organism) Salmonella enterica subsp. enterica serovar Gallinarum
NCBI Nucleotide GI 46811320
NCBI Protein GI 46811321
Protein Accession AAT01929.1
Taxonomy ID 594
Gene Strand (Orientation) ?
Protein Name cAMP receptor protein
Protein Note cyclic AMP receptor protein; CAP; catabolite gene activator protein
DNA Sequence
>gi|46811320|gb|AY594269.1| Salmonella enterica subsp. enterica serovar Gallinarum cAMP receptor protein gene, complete cds
CAATCTATTTTCGTAGCCCCCTTCCCAGGTAGCGGGAAGTATATTTTTGCAACCCCAGAGACAGTGCCGT
TTTCTGGCTCTGGAGACAGCTTATAACAGAGGATAACCGCGCATGGTGCTTGGCAAACCGCAAACAGACC
CGACTCTTGAATGGTTCTTGTCTCATTGCCACATTCATAAGTACCCGTCAAAGAGCACGCTGATTCACCA
GGGTGAAAAAGCAGAAACGCTGTACTACATCGTTAAAGGCTCCGTGGCAGTGCTGATCAAAGATGAAGAA
GGGAAAGAAATGATCCTTTCTTATCTGAATCAGGGTGATTTTATTGGTGAACTGGGCCTGTTTGAAGAAG
GCCAGGAACGCAGCGCCTGGGTACGTGCGAAAACCGCATGTGAGGTCGCTGAAATTTCCTACAAAAAATT
TCGCCAATTAATCCAGGTCAACCCGGATATTCTGATGCTCCTCTCTTCCCAGATGGCTCGTCGCTTACAA
GTCACCTCTGAAAAAGTAGGTAACCTCGCCTTCCTTGACGTCACCGGGCGTATCGCTCAGACGCTGCTGA
ATCTGGCGAAACAGCCCGATGCCATGACGCACCCGGATGGGATGCAGATCAAAATCACCCGTCAGGAAAT
CGGCCAGATCGTCGGCTGCTCCCGCGAAACCGTTGGTCGTATTTTGAAAATGCTGGAAGATCAAAACCTG
ATCTCCGCGCATGGCAAGACCATCGTCGTCTACGGCACCCGTTAATTCCGTCAGAATGGCG
Molecule Role Virmugen
Molecule Role Annotation A crp mutant is attenuated in mice and induces significant protection from challenge with wild type S. gallinarum (Rosu et al., 2007).
Related Vaccines(s) Salmonella Gallinarum crp mutant vaccine
References