VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

ssrA

Gene Name ssrA
Sequence Strain (Species/Organism) Yersinia pestis CO92
NCBI Gene ID 1173948
Locus Tag YPOs04
Taxonomy ID 214092
Gene Starting Position 1245587
Gene Ending Position 1245950
Gene Strand (Orientation) +
DNA Sequence
>gi|16120353:1245587-1245950 Yersinia pestis CO92 chromosome, complete genome
TTGGTGGAGCTGGGGGGATTTGAACCCCCGTCCGAAATTACTACACCGTCGGCACTACATGCTTAGTCCA
ATCATTACATTCGCCGGCCAGCTGCGGATGGACACGCTACTGACAAACTATCCTGATTAGTTTTAATGCT
TCCACCCCAGGCAAGGTTTCCACACGAGCTCTTTTAGGTTTGACCTCTCTTGATCCCCGTCCTAAGAGCG
GAGGCTAGGGAGAGAGGGCTCTAAGCAGGTTATTAAGCTGCTAGTGCGTAGTTTTCGTCGTTTGCAACTA
TTTTTTTTGCGGTTTTTTACGAGGCCACCGCACCTCGGCATGCACCTTGGGTTTCGCGAATCCCGTCGAA
TCCAGAATCAGCCC
Molecule Role Virmugen
Molecule Role Annotation An smpB mutant, in combination with an ssrA mutation, is attenuated in mice and induces significant protection from challenge with wild type Y. pestis (Okan et al., 2010).
Related Vaccines(s) Yersinia pestis smpB/ssrA mutant vaccine
References