VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

Murine leukemia virus

Table of Contents
  1. General Information
    1. NCBI Taxonomy ID
    2. Introduction
  2. Vaccine Related Pathogen Genes
    1. Complete genome (Other)
  3. Vaccine Information
  4. References
I. General Information
1. NCBI Taxonomy ID:
11786
2. Introduction
The murine leukemia virus (MuLV) is one of the simplest retroviruses. The virus uses the mouse as a host and is able to cause cancer in the host. The retrovirus MuLV has a positive, single-stranded sense RNA that replicates via reverse transcription. The virus has been of interest since its discovery the beginning of 1950’s. The virus was considered significant since it was shown to induce leukemia in inoculate mice. While it hasn’t been shown to be effective at infecting humans, it has still proven to be relevant in the study of viral infection in humans through the observation of its behavior in mice models. As a retrovirus, it has also been targeted for possible use as a viral vector (MicrobeWiki - Murine Leukemia Virus).
1. Complete genome
  • Gene Name : Complete genome
  • Sequence Strain (Species/Organism) : Murine leukemia virus
  • NCBI Nucleotide GI : 378404894
  • NCBI Protein GI : 53749063
  • Protein Accession : BAD52415.1
  • Taxonomy ID : 11786
  • Gene Strand (Orientation) : ?
  • Protein Name : GAG polyprotein precursor
  • Protein Note : Graffi GV-1.4
  • DNA Sequence : Show Sequence
    >gi|378404894|dbj|AB187566.2| Murine leukemia virus Graffi GV-1.4 DNA, complete genome
    GCGCCAGTCCTCCGATAGACTGTGTCGCCCGGGTACCCGTTCCTAATAAAGCCTCTTGCTGTTTGCATCC
    GAATCGTGGTCTCGCTGGTCCTTGAGAGGGTCTCCTCAGATTGATTGACTGCCCACCTCGGGGGTCTTTC
    ATTTGGGGGCTCGTCCGGGATCCGGAGACCCCAGCCCAGGGACCACCGACCCACCACCGGGAGGTAAGCT
    GGCCAGCAACTGATCTGTGTCTGTCCGATTGTCCTGTATCTGTGACTGATTTTATGCGCCTGCGTCTGTA
    CTAGTTGGCCGACTAGCTCTGTACCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGC
    AACCCTGGGAGACGTCCCGGGGACTCCAGGGGCCGTTTTCGTGGCCCGGCCTGAGTCCAAAAGCCCTGAT
    CGCTTTGGACTTTTTGGCGCACCCCCCTTAGAAGAGGGGTACGTGGTCCTAGTAGGGGACGAGAGGCTGA
    AACAGTTTCCGCCTCCGTCTAAATTTTTGCTTTCGGTTTGGAGCCGAAGCCGCGCCGCGCGTCTCGTCTG
    CTGCAGCATCGTTCTGTGTTGTTTCTGTCTGAGCGTGTTTTTGTATTTGTCTGAAAATATGGGCCAGACT
    GTTGTCACTCCCTTAAGTCTGACCCTAGATCACTGGAAGGATGTCGAGCGGATCGCTCACAACCAGTCGG
    TAGATATCAAGAAAAGGCGGTGGGTCACCTTCTGCTCTGCAGAATGGCCGACCTTTAACGTCGGATGGCC
    GCAGGACGGCACTTTCGACCGAGGCATTATCACCCAAGTTAAGATCAAGGTCTTTTCACCTGGTCCGCAT
    GGGCACCCGGACCAGGTCCCCTATATTGTGACCTGGGAAGCCTTGGCATTTGACCCCCCCCCTTGGGTCA
    AGCCCTTCGTACCTTCTAAACCTCCTCTTCCCCCTTCCGCCCCGTCCCTCTCTCCTGAACCTCCGCTTTC
    GACCCCGCCTCGATCTTCCCTCTATCCGGCCCTTACTCCACCTGTAAGCACCAAACCTAAAGTTCTTTCT
    GACAGTGGGGGGCCGCTCGTCGACCTGCTTGCAGAAGACCCCCCACCTTACAGAGGCCCAGGGTCACCCC
    CTCCCGACGGAGACGGGGATGGCGGGGAAGCGGCCCCTGCCGAAGAGACACCTGACCCCTCCCCAATGGC
    GTCTCGCCTGCGAGGAAGACGAGAGCCCCCCGTGGCAGACTCCACCACCTCGCAGGCACTCCCCCTCCGT
    TTAGGGGGAAACGGGCAGCTCCAGTACTGGCCGTTCTCCTCCTCTGACCTGTATAATTGGAAAAATAACA
    ACCCTTCTTTTTCTGAGGATCCAGGTAAATTGACTGCTCTAATTGAGTCAGTCCTTATTACTCACCAGCC
    CACCTGGGATGACTGCCAGCAGCTATTAGGGACCCTGTTGACCAGTGAAGAAAAACAACGGGTACTCTTG
    GAAGCTAGGAAAGCCGTCAAGGGCGACGATGGGCGCCCTACCCAGTTACCCAACGAGGTCAACGCAGCTT
    TTCCCCTTGAGCGTCCCAACTGGGATCATACCACCCAAGAAGGTAGGAACAACCTAGTCCTCTATCGCCA
    GTTGCTCCTAGCGGGTCTCCAAAACGCGGGCAGAAGCCCCACCAATTTGGCCAAGGTAAAAGGGATAACA
    CAGGGGCCCAATGAGTCTCCCTCAGCTTTTCTAGAGAGGCTTAAGGAAGCCTATCGTAGGTACACCCCCT
    ACGATCCTGAAGACCCTGGACAAGAGACTAACGTGGCTATGTCTTTCATTTGGCAGTCTGCCCCAGATAT
    TGGGAGAAAGTTAGAGAGATTAGAAGACTTAAGGAGTAAAACGCTTGGAGACCTAGTGAGAGAGGCAGAA
    AAGATATTCAATAAAAGAGAGACACCTGAAGAAAGGGAGGAACGGATCCGAAGGGAGACTGAAGAGAAAG
    AAGAACGCTGGAGAGCTGAAGATGAACAGAGAGAAAAGGAAAGAGATCGTAGGAGACATAGAGAAATGAG
    CAAGCTATTGGCTACTGTCGTTAGTGGTCAGAAACAGGATAGACAGGTGGGAGAGCGAAGGAGGCCCCAA
    CTCGATCATGACCAGTGTGCCTACTGTAAAGAAAAGGGGCACTGGGCTAAGGATTGTCCCAAGAAACCAC
    GAGGGCCTCGAGGACCGAGACCCCAGACCTCCCTCCTGACCCTAGATGACTAGGGAGGTCAGGGTCAGGA
    CCCCCCCCCTGAACCCAGGATAACCCTCAAAGTTGGGGGGCAACCCGTCACCTTCCTGGTAGATACTGGG
    GCCCAACACTCCGTGCTGACCCAAAATCCTGGACCCCTAAGTGACAAGTCTGCCTGGGTCCAAGGGGCTA
    CTGGAGGAAAGCGGTATCGCTGGACCACGGATCGCAAAGTACATCTAGCTACCGGTAAGGTCACCCACTC
    TTTCCTCCATGTACCAGACTGCCCCTATCCTCTGTTAGGAAGAGACTTGCTGACTAAACTAAAAGCCCAG
    ATCCACTTCGAGGGATCAGGAGCTCAGGTTGTGGGACCAATGGGACAGCCCCTGCAAGTGCTGACCCTAA
    ACATAGAAGATGAGTATCGGCTACATGAGACCTCAAAAGAGCCGGATGCTTCTCTAGAGTCCACATGGCT
    TTCTGATTTTCCCCAGGCCTGGGCGGAAACCGGGGGCATGGGACTGGCAGTTCGCCAAGCGCCTCTGATT
    ATACCTCTAAAAGCAACCTCCACCCCTGTGTCCATAAAACAATACCCCATGTCGCAAGAAGCCAGACTGG
    GGATCAAGCCCCACATACAGAGGCTGTTGGACCAGGGAATATTGGTACCCTGCCAGTCCCCCTGGAATAC
    ACCCCTGCTACCCGTTAAGAAACCAGGGACTAATGATTATAGGCCTGTCCAAGATTTGAGAGAAGTCAAC
    AAGCGGGTGGAAGATATCCACCCCACCGTGCCCAACCCTTACAACCTCCTGAGCGGGCTCCCACCGTCTC
    ACCAGTGGTACACTGTACTTGACTTGAAAGATGCTTTTTTCTGCTTAAGACTCCACCCCACTAGCCAGCC
    TCTCTTCGCCTTTGAGTGGAGAGACCCAGAGATGGGAATCTCGGGACAGTTGACCTGGACCAGACTTCCA
    CAAGGCTTCAAGAACAGCCCCACTCTGTTCGACGAGGCATTGCATAGAGACCTAGCAGGCTTCCGGATCC
    AGCATCCAGACTTGATCCTGCTGCAATACGTGGATGACTTACTGCTAGCCGCCACTTCCGAAAACGACTG
    CCAACAAGGTACTCGGGCCCTGTTACAGATCTTAGGGGACCTCGGGTATCGGGCCTCGGCCAAGAAAGCC
    CAAATCTGCCAGAAACAGGTCAAGTATCTGGGGTATCTTCTAAAAGAGGGTCAGAGATGGCTGACTGAGG
    CCAGAAAGGAGACTGTGATGGGGCAGCCTATTCCGAAGACCCCTCGACAACTAAGGGAGTTCCTAGGGAC
    GGCAGGCTTCTGTCGCCTCTGGATCCCGGGGTTTGCAGAAATGGCAGCCCCCTTGTACCCTCTCACCAAA
    ACGGGGACTCTGTTTAATTGGGGCCCAGACCAGCAAAAGGCCTATCAAGAAATCAAACAGGCTCTTCTAA
    CGGCCCCAGCCTTGGGGTTACCAGACTTGACTAAGCCCTTTGAACTCTTTGTTGACGAGAAGCAGGGCTA
    CGCCAAAGGCGTCCTAACGCAGAGACTGGGACCCTGGCGTCGGCCGGTGGCCTACCTGTCCAAAAAGCTC
    GACCCCGTGGCCGCGGGATGGCCCCCTTGCTTGCGGATGGTGGCTGCCATTGCCGTTCTGACAAAAGATG
    CAGGCAAGCTCACCCTGGGACAGCCGCTAGTCGTTCTAGCCCCCCATGCGGTGGAGGCGCTAGTCAAACA
    ACCCCCTGACCGCTGGCTCTCCAACGCCCGGATGACTCACTATCAGGCTTTGCTTCTGGACACGGACCGG
    GTCCAGTTCGGACCGGTGGTGGCCCTGAACCCGGCTACGCTGCTTCCACTGCCTGAGGAAGGGCTACGAC
    ATGACTGCCTTGATATTCTGGCCGAAGCCCACGGAACTAGACCGGACTTAACGGACCAGCCACTCCCCGA
    CGCCGACCACACCTGGTACACGGATGGGAGCAGTTTCCTGCAAAAAGGGCAGCGTAAGGCCGGAGCAGCG
    GTAACCACCGAGACCGAGGTAATCTGGGCCAAGGCGTTGCCATCCGGGACATCGGCCCAGAGAGCTGAAC
    TAATAGCACTCACCCAAGCCCTAAAGATGGCAGAAGGTAAGAAGCTAAATGTTTATACTGATAGCCGCTA
    TGCCTTTGCTACTGCCCATATTCATGGAGAGATATATAGGAGGCGTGGATTGCTCACATCAGAGGGGAAA
    GAGATCAAAAACAAAGGTGAAATCTTGGCCCTATTAAAAGCCCTCTTTCTGCCTAAAAGACTTAGCATAA
    TCCATTGCCCAGGACACCAAAAAGGAAACAGCGCGGAGGCCAGAGGCAACCGAATGGCTGACCAAGCGGC
    CCGAGAAATAGCCTCTAAAGAAACCCCAGAGACTTCCACACTGCTTATAGAAAATTCAACACCCTATACC
    CATGAACATTTTCATTACACAGTGACTGACATAAAGGACCTAACTAAGTTGGGAGCCACTTATGATAAAA
    CAAAGAAGTACTGGGTCTACCAAGGGAAACCTGTGATGCCCGACCAATTTACCTTTGAATTATTAGATTT
    TCTCCATCAGTTGACCCACCTCAGTTTCTCAAAGACAAAGGCTCTCCTAGAGAGAAGCCACAGTCCCTAC
    TACATGCTGAACCGGGATCGAACACTGAAAAATATCATTGAGACCTGCCAAGCTTGTGCGCAAGTCAATG
    CCAGCAAGTCAGCCGTTACCCAAGGAACTAGGGTCCGCGGACATCGGCCCGGTACTCACTGGGAGATCGA
    TTTTACCGAGGTAAAGCCTGGACTGTATGGGTATAAATATCTTCTAGTTTTTGTAGACACCTTCTCTGGC
    TGGGTTGAAGCCTCCCCTACTAAGAAAGAAACCGCCAAGGTCGTAACCAAGAAACTACTAGAAGAGATCT
    TCCCCAGGTTCGGCATGCCACAGGTATTGGGAACAGACAATGGGCCTGCCTTCGTCTCCAAGGTGAGTCA
    GACAGTAGCCGATTTAATGGGGATTGATTGGAAACTACATTGTGCATACAGACCCCAAAGCTCAGGTCAG
    GTAGAAAGAATGAATAGGACCATCAAGGAGACTTTAACTAAATTAACGCTTGCAACTGGCTCTAGAGACT
    GGGTGCTTCTACTCCCCCTAGCCCTGTATCGAGCCCGCAACACGCCGGGCCCCCATGGCCTCACCCCGTA
    CGAGATCTTATATGGAGCACCTCCGCCCCTTGTAAACTTCCCTGATCCTGACATGACGAGAGTCACTAAC
    AGCCCCTCTCTCCAAGCTCACTTGCAGGCCCTCTACTTAGTCCAGCACGAAGTCTGGAGACCGCTGGCTG
    CAGCCTACCAGGAACAACTGGACCGGCCGGTGGTACCCCACCCTTACCAGGTCGGCGACACAGTGTGGGT
    CCGCCGACACCAGACTAAGAACCTTGAACCTCGCTGGAAGGGACCTTACACCGTCCTGCTGACCACCCCC
    ACCGCCCTCAAAGTAGACGGCATCGCAGCCTGGGTCCACGCCGCCCACGTGAAGGCAGCCAATACTGGGA
    GTGGACCATCCTCTGGACTGACATGGCGCGTGCAACGCTCTCAAAACCCCTTAAAAATAAGGCTAACCCG
    CAAGGCCCCCTAGTCCCCCTAATCCTTTTGATTCTCAGAGGAGTCAGTACCGCCTCGCCTGGCTCCAGCC
    CTCACCGGGTCTATAACATCACCTGGGAGATAACCAATGGAGATCGGGAGGTGGTATGGGCAATATCTGG
    CAACCACCCCCTGTGGACCTGGTGGCCTGACCTCACCCCAGATTTATGCATGTTGGCCCACCATGGACCA
    TCTTATTGGGGCCTAGAGTATCAGTCCCCTTTCTCCTCTCCCCCGGGGCCCCCTTGTTGCTCAGAGAGCA
    GCAAGTCTAGCCGGGGCTGTTCCAGAGACTGTGAAGAACCCTTAACCTCCCTCACTCCCCGGTGCAGCAC
    TGCCTGGAACAGGCTGAAACTGGACAAGGTAACCCATGCACCCAATGAGGGATTCTATATCTGCCCGGGG
    TTTCATCGCCCCCGGTGGTCCAAGTCATGTGGGGGCCCAGACTCCTTTTACTGTGCCTCATGGGGTTGTG
    AGACCACCGGACGGGCATATTGGAAACCCTCCTCTTCCTGGGATTACATCACAGTAGACAACAACCTCAC
    CTCCAGTCAAGCTGCCCCAATATGTAAAGCCAATAAATGGTGTAACCCCTTAGTTATCCGGTTTACGGAT
    GCCGGAAAACGTGTTACCTCTTGGGTCACAGGACATCACTGGGGCCTACGCTTGTATGTCTCCGGACAAG
    ACCCAGGGCTCAATTTTGGAATCCGATTCAAATACCAAAGTTTGGGACCCCGAGTTCCCATAGGGCCAAA
    CCCCGTCCTGGCGGTTCCACAACCACCCTTGGTGTCAGAAGTTAAGACCCCCTCAGCCACCAACTCCACC
    AGCTCGCCAGGTGAGACTCCTCTCTCTCTCACCCAACTTCCACCAGTGGGAACGGGAAATAGGTTACTAA
    ACTTGGTAGATGGAGCCTACCAAGCTCTCAACCTCACCAGTCCTGACAGAACTCAAGAGTGCTGGTTGTG
    TCTGGTGACGGAACCCCCCTACTACGAAGGAGTTGCCGTTCTAGGGACTTATTCTAACCATACCTCTGCT
    CCAGCTAACTGCTCCGTGGCCTCCCAACACAAGCTGACCCTGTCCGAAATAACCGGACAGGGACTCTGCG
    TAGGAGCAATTCCCAAAACCCATCAGGCCCTATGCAATGTCACCCAGACAAACAGCCCAGGGACCCATTA
    TTTAGTTGCCCCTGCAGGTACCATGTGGGCATGTAATACAGGGCTTACCCCATGTCTCTCCACCGCTGTA
    CTTGATCTTACCACTGATTATTGTGTTCTTGTTGAACTCTGGCCAAGGGTCACCTATCATTCCCCCAGCT
    ATGTTTACAGCCAGTTCGAAAGATCCATCCGACACAAAAGAGAACCGGTGTCGTTAACATTGGCCCTATT
    GTTGGGTGGACTAACCATGGGGGGAATTGCCGCAGGGATAGGAACAGGAACTACTGCTCTGATGGCCTCT
    CAGCAGTTCCAGCAGCTCCATGCTGCTGTACAGGATGACCTTAAAGAAATTGAAAAGTCAATCTCTAACC
    TAGAAAAATCTCTTACTTCACTGTCTGAAGTTGTCTTACAGAATCGAAGAGGCCTAGACTTGTTATTCCT
    AAAAGAAGGAGGGCTGTGTGCTGCTTTAAAAGAAGAATGTTGTTTCTATGCAGACCACACAGGACTAGTA
    AGGGACAGCATGGCCAAGTTGAGAGAGAGGCTCAACCAGAGACAAAAACTGTTTGAGTCAGGTCAGGGAT
    GGTTTGAGGGACTGTTTAACAGGTCCCCATGGTTCACGACTTTGATATCCACCATTATGGGCCCCTTGAT
    AATACTTTTATTAATCCTACTCCTCGGACCCTGTATTCTCAACCGCTTGGTCCAGTTTGTAAAAGACAGA
    ATTTCGGTGGTGCAGGCCCTGGTTCTGACCCAACAGTATCACCAACTCAAATCAATAGATCCAGAAGAAG
    TGGAGTCACGTGAATAAAAGATTTTATTCAGTTTCCAGAAAGAGGGGGGAATGAAAGACCCCACCATAAG
    GCTTAGCAAGCTAGCTACAGTAACGCCATCTTGCAAGGCCTGGAAAAATACAGGACTGAGAATAGGGAAG
    TTCAGATCAAGGTCAGAGCAGAAAAACAGCTGCAGTTGGGCCAAACAGGATATCTGTGGTGAGCAGTTTC
    GGGCCCCGGCCCGGGGGCAAGAACAGATGGTCCCCAGATATGGCCTAACCCTCAGCAGTTTCAAGAGACC
    CATCAGATGTTTCCAGGTTGCCCCAAAGACCTGAAACGACCTTGCGCCTCATTTGAACTAACCAATCAGC
    CCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCTATAAAAGAGGCCCAAGAACCCTTACTC
    GGCGCGCCAGTCCTCCGATAGACTGTGTCGCCCGGGTACCCGTTCCTAATAAAGCCTCTTGCTGTTTGCA
  • Molecule Role : Other
III. Vaccine Information
IV. References
1. MicrobeWiki - Murine Leukemia Virus: Murine Leukemia Virus (MuLV) [http://microbewiki.kenyon.edu/index.php/Murine_Leukemia_Virus_(MuLV)]