VO Banner
Search: for Help
Register or Login
Vaccine & Components
Vaccine Mechanisms
Vaccine Literature
Vaccine Design
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Data Exchange
Help & Documents
Contact Us

Vibrio vulnificus

Table of Contents
  1. General Information
    1. NCBI Taxonomy ID
  2. Vaccine Related Pathogen Genes
    1. rtxA1 (Protective antigen)
  3. Vaccine Information
  4. References
I. General Information
1. NCBI Taxonomy ID:
1. rtxA1
  • Gene Name : rtxA1
  • Sequence Strain (Species/Organism) : Vibrio vulnificus
  • NCBI Protein GI : ADX36405
  • Other Database IDs : CDD:288492
  • Taxonomy ID : 672
  • Protein Name : putative RTX-toxin
  • Protein pI : 5
  • Protein Weight : 240654.284
  • Protein Length : 2436
  • Protein Note : biotype: 1; PCR_primers=fwd_name: CMCP6-VV2-for-5370, fwd_seq: tgctgtggcgaaaagtaacg
  • Protein Sequence : Show Sequence
    >ADX36405.1 putative RTX-toxin, partial [Vibrio vulnificus]
  • Molecule Role : Protective antigen
  • Molecule Role Annotation : (Lee et al., 2014)
III. Vaccine Information
IV. References
1. Lee et al., 2014: Lee TH, Kim MH, Lee CS, Lee JH, Rhee JH, Chung KM. Protection against Vibrio vulnificus infection by active and passive immunization with the C-terminal region of the RtxA1/MARTXVv protein. Vaccine. 2014; 32(2); 271-276. [PubMed: 24252692].