VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

Vaccine Comparison

Bordetella bronchiseptica aroA mutant vaccine (strain BBS18) Bordetella bronchiseptica aroA/trpE mutant vaccine Bordetella bronchiseptica bscN and cyaA double mutant vaccine
Vaccine Information Vaccine Information Vaccine Information
  • Vaccine Ontology ID: VO_0002801
  • Type: Live, attenuated vaccine
  • Status: Research
  • aroA gene engineering:
    • Type: Gene mutation
    • Detailed Gene Information: Click Here.
  • Preparation: A B. bronchiseptica aroA mutant was constructed by allelic exchange. Introduction of the Km-R cassette into the aroA gene of this strain was confirmed by PCR using aroA-specific primers (aroAfw 5′GGCGTGCAAAGCGGGGCGGACTGGCTGGAG3′ and aroArv 5′ATAATCGGGGAAAGTCTTGCTGACGCAGCC3′) and by Southern blotting and DNA:DNA hybridization using an aroA-specific probe generated by PCR (Stevenson and Roberts, 2002).
  • Immunization Route: intranasal immunization
  • Type: Live, attenuated vaccine
  • Status: Research
  • Host Species as Laboratory Animal Model: Mouse
  • aroA gene engineering:
    • Type: Gene mutation
    • Description: This aroA/trpE mutant is from Bordetella bronchiseptica (McArthur et al., 2003).
    • Detailed Gene Information: Click Here.
  • trpE gene engineering:
    • Type: Gene mutation
    • Description: This aroA/trpE mutant is from Bordetella bronchiseptica (McArthur et al., 2003).
    • Detailed Gene Information: Click Here.
  • Immunization Route: intranasal immunization
  • Type: Live, attenuated vaccine
  • Status: Research
  • bscN gene engineering:
    • Type: Gene mutation
    • Detailed Gene Information: Click Here.
  • cyaA gene engineering:
    • Type: Gene mutation
    • Detailed Gene Information: Click Here.
  • Preparation: An isogenic mutant of RB50 containing an in-frame deletion of the adenylate cyclase toxin gene (cyaA), was constructed with an in-frame deletion of the ATPase (bscN) gene required for type III secretion (Mann et al., 2007).
  • Immunization Route: intranasal immunization
Host Response Host Response Host Response

Mouse Response

  • Host Strain: BALB/c
  • Persistence: Wild type B. bronchiseptica could still be detected in lungs up to 56 days post-infection. In contrast, the numbers of BBC18 did not increase following inoculation, but decreased rapidly, and were cleared from the lungs completely by day 6.The nasal cavity samples showed the same trend and were also clear of bacteria after 6 days. The behaviour of the mutant and the wild type strain was mirrored in outbred NIH-S mice. Thus the B. bronchiseptica aroA mutant is highly attenuated (Stevenson and Roberts, 2002).
  • Efficacy: Immunization with GVB120 (B. bronchiseptica aroA mutant expressing FrgC), by either regime, had a major effect on colonization of the lungs, trachea and nasal cavity by wild type B. bronchiseptica BBC17. The effect of immunization on the subsequent colonization with BBC17 was more pronounced in the lower than the upper respiratory tract (Stevenson and Roberts, 2002).
  • Host IgA response
    • Description: High titers of anti-B. bronchiseptica IgA were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click Here.
  • Host IgG response
    • Description: High titers of anti-B. bronchiseptica IgG were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click Here.
  • Host IgM response
    • Description: High titers of anti-B. bronchiseptica IgM were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click Here.

Mouse Response

  • Persistence: An aroA/trpE mutant is attenuated in mice (McArthur et al., 2003).
  • Efficacy: An aroA/trpE mutant induces significant protection from challenge with wild type B. bronchiseptica (McArthur et al., 2003).

Mouse Response

  • Persistence: TLR4def and TNF-α−/− mice were intranasally inoculated with 103, 104, or 105 CFU of RB50 or 105 CFU of AVS in a 50-μl inoculum and observed them for signs of severe disease. WT mice given similar doses of RB50 are able to control the disease and to clear bacteria from the lower respiratory tract (Mann et al., 2007).
  • Efficacy: The nasal cavities of vaccinated TLR4def mice and TNF-α−/− mice contained 10,000-fold fewer CFU than those of control mice. The tracheae and lungs of vaccinated TLR4def mice and TNF-α−/− mice contained <20 CFU, while the same organs of control mice contained approximately 106 and 108 CFU, respectively. These results indicate that low-dose intranasal vaccination with AVS protects susceptible mice from severe infection by a variety of B. bronchiseptica strains (Mann et al., 2007).
  • Host Ifng (Interferon gamma) response
    • Description: AVS induces significantly increased IFN-gamma production in mouse splenocytes as compared to naive mice. This increase occurred 28 days after vaccination and after stimulation with heat-killed RB50 (Mann et al., 2007).
    • Detailed Gene Information: Click Here.
  • Host Il10 (interleukin 10) response
    • Description: AVS induces decreased IL-10 production in mouse splenocytes as compared to inoculation with wild type strain. This decrease occurred 28 days after vaccination and after stimulation with heat-killed RB50. However, IL-10 was significantly upregulated in splenocytes compared to naive mice (Mann et al., 2007).
    • Detailed Gene Information: Click Here.
References References References
Stevenson and Roberts, 2002: Stevenson A, Roberts M. Use of a rationally attenuated Bordetella bronchiseptica as a live mucosal vaccine and vector for heterologous antigens. Vaccine. 2002; 20(17-18); 2325-2335. [PubMed: 12009288].
McArthur et al., 2003: McArthur JD, West NP, Cole JN, Jungnitz H, Guzmán CA, Chin J, Lehrbach PR, Djordjevic SP, Walker MJ. An aromatic amino acid auxotrophic mutant of Bordetella bronchiseptica is attenuated and immunogenic in a mouse model of infection. FEMS microbiology letters. 2003; 221(1); 7-16. [PubMed: 12694904].
Mann et al., 2007: Mann P, Goebel E, Barbarich J, Pilione M, Kennett M, Harvill E. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infection and immunity. 2007; 75(7); 3665-3672. [PubMed: 17452472].