• Type: Aerosal Vaccine
• Antigen: The vaccines tested in this study include B. abortus unmarked mutants BAΔasp24, BAΔvirB2, and BAΔmanBA, and B. melitensis unmarked mutants BMΔasp24, BMΔvirB2, and BMΔmanBA (Kahl-McDonagh et al., 2007).
• asp24 gene engineering:
  • Type: Gene mutation
  • Description: This asp24 mutant is from Brucella abortus (Kahl-McDonagh et al., 2007).
  • Detailed Gene Information: Click Here.
• virB2 gene engineering:
  • Type: Gene mutation
  • Description: This virB2 mutant is from Brucella melitensis (Kahl-McDonagh et al., 2007).
  • Detailed Gene Information: Click Here.
• manA gene engineering:
  • Type: Gene mutation
  • Description: This manBA mutant is from Brucella melitensis (Kahl-McDonagh et al., 2007).
  • Detailed Gene Information: Click Here.
• manB gene engineering:
  • Type: Gene mutation
  • Description: This manBA mutant is from Brucella melitensis (Kahl-McDonagh et al., 2007).
  • Detailed Gene Information: Click Here.
• Preparation: Each vaccine consisted of 5 × 10^7 CFU/ml in a chamber nebulizer, which is thousands of organisms per dose. The bacteria were introduced in Farrell's medium: TSA supplemented with 5 mg/liter nalidixic acid, 25,000 IU/liter bacitracin, 100 mg/liter cycloheximide, 5000 IU/liter polymyxin B sulfate, 20 mg/liter vancomycin, 100,000 IU/liter nystatin 10% (vol/vol) horse serum, and 2% (wt./vol.) dextrose (Kahl-McDonagh et al., 2007).

• Vaccine Ontology ID: VO_0011380
• Type: DNA vaccine
• Status: Research
• Antigen: B. abortus ribosomal protein rplL and outer membrane lipoprotein 16
• RplL gene engineering:
  • Type: DNA vaccine construction
  • Description: Full-length open reading frames of the L7/L12 gene and Omp16 gene were amplified with PCR from the genome of attenuated B. abortus strain RB51. The gene amplified with L7/L12 primers (FL and RL-1) and the gene amplified with Omp16 primers (FO and RO) were inserted into pcDNA3.1(+) vector (Invitrogen) at the EcoRV/XhoI and BamHI/XhoI sites to construct recombinant plasmids L7/L12-pcDNA3.1 and Omp16-pcDNA3.1, respectively. To construct the recombinant fusion plasmid L7/L12-Omp16-pcDNA3.1, the L7/L16 gene fragment was amplified with the L7/L16 PCR primers (FL and RL-2) first, which removed only the TAA stop codon from the L7/L16 gene. This PCR product and the amplified Omp16 gene above were digested with EcoRV/BamHI and BamHI/XhoI, respectively, and ligated with T4 ligase; the ligated product was then inserted into the pcDNA3.1(+) vector between the EcoRV and XhoI sites (Luo et al., 2006b).
  • Detailed Gene Information: Click Here.
• Omp16 gene engineering:
  • Type: DNA vaccine construction
  • Description: Full-length open reading frames of the L7/L12 gene and Omp16 gene were amplified with PCR from the genome of attenuated B. abortus strain RB51. The PCR primers were designed as shown in Table 1. The gene amplified with L7/L12 primers (FL and RL-1) and the gene amplified with Omp16 primers (FO and RO) were inserted into pcDNA3.1(+) vector (Invitrogen) at the EcoRV/XhoI and BamHI/XhoI sites to construct recombinant plasmids L7/L12-pcDNA3.1 and Omp16-pcDNA3.1, respectively. To construct the recombinant fusion plasmid L7/L12-Omp16-pcDNA3.1, the L7/L16 gene fragment was amplified with the L7/L16 PCR primers (FL and RL-2) first, which removed only the TAA stop codon from the L7/L16 gene. This PCR product and the amplified Omp16 gene above were digested with EcoRV/BamHI and BamHI/XhoI, respectively, and ligated with T4 ligase; the ligated product was then inserted into the pcDNA3.1(+) vector between the EcoRV and XhoI sites (Luo et al., 2006b).
  • Detailed Gene Information: Click Here.
• Vector: Expression vector pcDNA3.1
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0000321
• Type: DNA vaccine
• Antigen: B. abortus BCSP31, SOD, and L7/L12 (Yu et al., 2007).
• SodC from B. abortus strain 2308 gene engineering:
  • Type: DNA vaccine construction
  • Description: The DNA vaccine comprising genes encoding the antigens BCSP31, superoxide dismutase (SOD), and L7/L12 was constructed and evaluated for its immunogenicity and protective efficacy (Yu et al., 2007).
  • Detailed Gene Information: Click Here.
• B. abortus strain 19 L7/L12 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• BCSP31 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• Vector: pJW4303 (Yu et al., 2007)
• Preparation: The coding regions for the antigens BCSP31, SOD, and L7/L12 were amplified from B. abortus strain 2308 chromosomal DNA. GenBank accession numbers for the sequences reported in this study are M20404 for BCSP31, L19101 for L7/L12, and AE017334 for SOD. All antigen-coding regions were fused individually to the tissue plasminogen activator signal sequences, and the DNA constructs were purified using the Qiagen Mega plasmid DNA kit (Qiagen, Valencia, CA) and verified by commercial DNA sequencing. The DNA vaccine was diluted in saline solution to a final concentration of 1–2 mg/mL before use (Yu et al., 2007).
• Virulence: None
• Description: Vaccine combines three known antigens, BCSP31, SOD, and L7/L12, in a single DNA vaccine.

• Vaccine Ontology ID: VO_0000018
• Type: DNA vaccine
• Antigen: B. abortus Cu/Zn Superoxide dismutase (Munoz-Montesino et al., 2004).
• SodC from B. abortus strain 2308 gene engineering:
  • Type: DNA vaccine preparation
  • Description: B. abortus sodC was subcloned into the expression vector pcDNA3 (Munoz-Montesino et al., 2004).
  • Detailed Gene Information: Click Here.
• Vector: pcDNA3 (Munoz-Montesino et al., 2004)
• Preparation: Recombinant plasmid pBAII-3, containing the gene for B. abortus Cu-Zn SOD (sodC), and its own promoter, was initially obtained from a pUC9 genomic library of B. abortus strain 2308. A 1.1-kb fragment containing the sodC gene and its promoter sequences was excised and ligated into the expression vector pcDNA3 downstream of the cytomegalovirus promoter. The resulting plasmid was designated pcDNA-SOD. A colony of E. coli containing pcDNASOD was cultured and used for large-scale plasmid DNA isolation. The DNA was resuspended in PBS at a final concentration of 1 mg/ml. The pcDNA-SOD plasmid construct was verified by restriction digestion and by sequencing of the complete insert (Munoz-Montesino et al., 2004).
• Description: Cu-Zn superoxide dismutase (SOD) is one of the protective immunogens of Brucella abortus. Intramuscular injection with a plasmid DNA carrying the SOD gene (pcDNA-SOD) was able to induce a protective immune response in mice (Munoz-Montesino et al., 2004).

• Vaccine Ontology ID: VO_0004393
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• SodC from B. abortus strain 2308 gene engineering:
  • Type: DNA vaccine construction
  • Description: Vector pcDNA3 expressed Cu-Zn SOD (Onate et al., 2003).
  • Detailed Gene Information: Click Here.
• Vector: pcDNA3 (Onate et al., 2003)
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0004392
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• Antigen: p39-L7/L12 fusion protein from RB51 (Luo et al., 2006a)
• B. abortus strain 19 L7/L12 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• P39 from Brucella abortus gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• Vector: pcDNA3.1 (Luo et al., 2006a)
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0004546
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• BAB1_0278 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• Vector: pVF (Sislema-Egas et al., 2012)
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0000421
• Type: DNA vaccine
• Antigen: Brucella abortus lumazine synthase (BLS) (Velikovsky et al., 2002). It was was cloned and identified in 1995 (Hemmen et al., 1995).
• ORF gene engineering:
  • Type: DNA vaccine preparation
  • Description: The Brucella abortus lumazine synthase (BLS) gene was cloned into the pcDNA3 plasmid. This gene is driven by the cytomegalovirus promoter. The plasmid was amplified in E. coli JM109 (Promega, Madison, Wis.) and isolated with Mega Prep plasmid isolation columns (Qiagen, Dorking, United Kingdom) (Velikovsky et al., 2002).
  • Detailed Gene Information: Click Here.
• Vector: pcDNA3 (Velikovsky et al., 2002)
• Preparation: The Brucella abortus lumazine synthase (BLS) gene was cloned into the pcDNA3 plasmid. It is driven by the cytomegalovirus promoter (Velikovsky et al., 2002).
• Virulence: No.
• Description: This is about pcDNA-BLS, a B. abortus DNA vaccine encoding lumazine synthase (Velikovsky et al., 2002).

• Vaccine Ontology ID: VO_0000022
• Type: Attenuated live vaccine
• Status: Licensed
• Location Licensed: USA; European countries
• Host Species for Licensed Use: Cattle
• Antigen: Whole Brucella organism
• Preparation: Strain 19, first described in 1930, is a laboratory-derived strain attenuated by an unknown process. It was originally isolated from bovine milk as a virulent strain in 1923, but became attenuated after storage at room temperature for over a year. Strain 19 is able to induce protective immunity in cattle (Schurig et al., 2002).
• Virulence: Although effective, strain 19 vaccine has a tropism for the placenta and causes abortion when given to pregnant cows , is infectious for humans , and causes serologic responses in calves that are the same as those in cattle infected with natural field strains (Cheville, 2000).
• Description: Strain 19 induces reasonable protection against B. abortus, but at the expense of persistent serological responses (Schurig et al., 2002).

• Vaccine Ontology ID: VO_0000323
• Type: Subunit vaccine
• Antigen: B. abortus ribosomal protein L7/L12 (Oliveira et al., 1996).
• B. abortus strain 19 L7/L12 gene engineering:
  • Type: Recombinant protein preparation
  • Description: Recombinant Brucella abortus L7/Ll2 ribosomal protein was fused to maltose binding protein (MBP). The detail is described (Oliveira et al., 1996).
  • Detailed Gene Information: Click Here.
• Preparation: The recombinant Brucella abortus L7/L12 ribosomal protein was fused to maltose binding protein (MBP). The animals vaccinated with MBP-L7/L12 received 25 mg of the specific B. abortus L7/L12 ribosomal protein. Different protein concentrations per dose containing the same MBP amounts were used to vaccinate each group to ensure that both mouse groups received the same amount of MBP (Oliveira et al., 1996).
• Virulence: None

• Tradename: RB51
• Manufacturer: Colorado Serum Company CZ Veterinaria
• Vaccine Ontology ID: VO_0000021
• Type: Live attenuated B. abortus strain
• Status: Licensed
• Location Licensed: USA, Mexico, South American, India, Spain, Middle East, Iran
• Host Species for Licensed Use: Cattle
• Antigen: The antigen for this live attenuated vaccine is the whole cells of strain RB51. This strain has rough characteristics and is devoid of O-chain. The RB51 was derived from the virulent smooth B. abortus 2308 by several passages in media supplemented with sub-inhibitory concentrations of rifampicin (Schurig et al., 1991).
• Virulence: RB51 is a rough attenuated strain (Schurig et al., 1991).
• Approved Age for Licensed Use: Calves (4–12 months of age) are vaccinated with RB51 at the full dose of 1.0–3.4 × 10^10 colony forming units. In Brucella-infected herds the vaccine can be safely used in cows at a reduced dose of 1.0 × 10^9 CFU (Poester et al., 2006).
• Description: RB51 has been the official cattle Brucella vaccine in the USA since 1996 and now in many other countries (Schurig et al., 2002). RB51 is a rifampin-resistant rough attenuated mutant of Brucella abortus derived by repeated passage of strain 2308 on Trypticase soy supplemented with 1.5% agar and varying concentrations rifampin or penicillin. Rabbits, goats and cattle hyperimmunized with sonicates of RB51 develop antibodies to B. abortus cellular antigens but do not develop specific antibodies for the Brucella O-chain (Schurig et al., 1991).

• Vaccine Ontology ID: VO_0000325
• Type: DNA vaccine
• Antigen: The antigen for this vaccine were found in eukaryotic expression vectors called pTargeTomp31, which encoded the outer membrane protein (omp31) of B. melitensis 16M (Gupta et al., 2007).
• Omp31 gene engineering:
  • Type: DNA vaccine construction
  • Description: The nucleotide sequence of the gene coding for the outer membrane protein omp31 reported for B. melitensis were synthesized by Qiagen. The primers were used to amplify a target sequence of 720 bp within a gene code for the production of a 28–31 kDa outer membrane protein (omp31) specific to the B. melitensis. The omp31 gene of B. melitensis was amplified with primers 5′-TGACAGACTTTTTCGCCGAA-3′ and 5′-TATGGATTGCAGCACCGC-3′. This 720 bp B. melitensis DNA fragment encoding omp31 was cloned in pTargeT mammalian expression system vector. The resultant plasmid (pTargeTomp31) contained the omp31 gene. Competent Escherichia coli JM109 was transformed with pTargeTomp31. Ampicillin-resistant colonies were grown in Luria-Bertani medium containing 100 μg/ml of ampicillin at 37 °C with agitation at 225 rpm. Protein expression was induced by adding 1 mM isopropyl-β-d-thiogalactopyranoside and incubating transformed cells for 4 h. Bacteria were pelleted by centrifugation and frozen at −20 °C. Bacterial cells were suspended in a solution consisting of 50 mM Tris, 5 mM EDTA, and 1% Triton X-100 at a pH of 8.0 and sonicated for three 1-min cycles at 4 °C. Inclusion bodies were pelleted at 20,000 × g for 30 min at 4 °C and washed twice with suspension solution without Triton X-100. Inclusion bodies were solubilized in a solution containing 50 mM Tris, 5 mM EDTA, and 8 M urea at a pH of 8.0 at room temperature overnight with agitation. After centrifugation, soluble protein was purified by chromatography through Ni-agarose. rOmp31 was adsorbed with Sepharose-polymyxin B to eliminate LPS contamination. Plasmid DNA for in vitro transfection or mouse immunization was extracted from a 16-h culture and purified using the Endo-Free Plasmid purification kit. Plasmid DNA was adjusted to a final concentration of 1 mg/ml in PBS and stored at −80 °C (Gupta et al., 2007) .
  • Detailed Gene Information: Click Here.
• Vector: pTargeT (Gupta et al., 2007)
• Preparation: B. melitensis 16M, the virulent strain, was isolated from the stomach content of the aborted fetus of the goat. B. melitensis DNA fragment encoding omp31 was cloned in pTargeT mammalian expression system vector. The plasmid was then purified and made into a vaccine consisting of 100 μg of pTargeTomp31 in 50 μl sterile saline (Gupta et al., 2007).
• Virulence: The strain isolated from the goat was virulent, bu the plasmid created was quite attenuated (Gupta et al., 2007).

• Vaccine Ontology ID: VO_0000411
• Type: Recombinant vector vaccine
• Antigen: Purified Brucella bp26 and trigger factor (Tf) proteins, also called Tig (Yang et al., 2007).
• Tig gene engineering:
  • Type: Recombinant protein preparation
  • Description: Recombinant bp26 and Tf were produced in Pichia pastoris and purified, and mixed with cholera toxin (CT) adjuvant(Yang et al., 2007).
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0000143
  • Description: Cholera toxin (CT) was used as the adjuvant for this vaccine (Yang et al., 2007).
• Preparation: Recombinant bp26 and Tf were produced in Pichia pastoris and purified. Each vaccine consisted of either 50 or 100 micrograms per dose of either bp26, Tf, or both combined with the CT adjuvant (Yang et al., 2007).

• Vaccine Ontology ID: VO_0000436
• Type: DNA vaccine
• Status: Research
• Antigen: Omp31 protein
• omp31 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0000142
  • Description: Incomplete Freund's Adjuvant
• Vector: pCI-neo prime, recombinant protein boost (Cassataro et al., 2005)
• Preparation: For the propagation of plasmids, Escherichia coli strain JM109 was used. For the expression of the recombinant protein, strain BL21(DE3) was employed. Bacterial strains were routinely grown, and rOmp31 was obtained and treated as described by (Estein et al., 2003). Purity was determined by Coomassie blue staining as described by (Cassataro et al., 2005). The plasmid pCIOmp31 was obtained as described in (Cassataro et al., 2005).
• Immunization Route: Intramuscular injection (i.m.)
• Description: A regimen of DNA prime and protein boost is followed, increasing the efficacy of the vaccine compared to DNA or protein alone (Cassataro et al., 2007).

• Vaccine Ontology ID: VO_0004397
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• IalB gene engineering:
  • Type: DNA vaccine construction
  • Description: Vector pCR3.1 expressed IalB (Commander et al., 2007).
  • Detailed Gene Information: Click Here.
• Vector: pcDNA3 (Commander et al., 2007)
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0004396
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• Omp25 gene engineering:
  • Type: DNA vaccine construction
  • Description: Vector pCR3.1 expressed Omp25 (25 kDa Omp) (Commander et al., 2007).
  • Detailed Gene Information: Click Here.
• Vector: pcDNA3.1 (Commander et al., 2007)
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0004394
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• omp31 gene engineering:
  • Type: DNA vaccine construction
  • Description: Vector pCI expressed Omp31 (hemin-binding protein) (Cassataro et al., 2005).
  • Detailed Gene Information: Click Here.
• Vector: pCI (Cassataro et al., 2005)
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0004395
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• ORF gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• omp31 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• Vector: pCI-neo (Cassataro et al., 2007)
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0000311
• Type: subunit vaccine
• Antigen: B. melitensis strain 16M lipopolysaccharide (LPS)
• Preparation: The LPS was extracted from killed cells and purified by a modification of the method of Bundle et al (Bhattacharjee et al., 2006).
• Virulence: None.
• Description: LPS, an outer membrane endotoxin common to gram negative bacteria, consists of three parts: Lipid A, a core oligosaccharide, and an O-antigen. The O-antigen is found in smooth strains only.

• Vaccine Ontology ID: VO_0000312
• Type: Subunit vaccine
• Antigen: The antigens used in this vaccine were purified Brucella melitensis lipopolysaccharide (LPS) as a noncovalent complex with Neisseria meningitidis group B outer membrane protein (GBOMP) (Bhattacharjee et al., 2002).
• Preparation: To create the vaccine, the LPS was extracted from killed B. melitensis cells and purified. N. meningitidis group B strain 8047 bacteria were grown in a synthetic medium, and outer membrane protein (GBOMP) was extracted. The B. melitensis LPS-GBOMP noncovalent complex vaccine was prepared with purified B. melitensis LPS dissolved in 42 ml of TEEN buffer. This mixture was added to the LPS solution and kept at 5°C for 30 min. The detergent was removed, and buffer was exchanged with sterile 0.9% NaCl solution. The final product was filtered and the LPS content was determined (Bhattacharjee et al., 2002).
• Storage: The vaccines were stored at −20°C until use (Bhattacharjee et al., 2002).

• Vaccine Ontology ID: VO_0000412
• Type: Subunit vaccine
• Antigen: Brucella melitensis 16M P39, a putative periplasmic binding protein (Al-Mariri et al., 2001).
• B. melitensis M5 P39 gene engineering:
  • Type: recombinant protein
  • Description: The bfr gene of Brucella melitensis 16M was subcloned into a pET-15b expression vector that contains a polyhistidine tag, and the resulting plasmid pET-15b-bfr was introduced in E. coli BL21(DE3). After 2 to 4 of induction with 1 mM IPTG (isopropyl-β-d-thiogalactopyranoside), bacterial cells from a 100-ml culture were washed once and then sonicated. The lysate was centrifuged for 10 min at 9,000 × g at 4°C. The pellet was kept frozen at −70°C. After it had thawed, the pellet was resuspended in a lysis buffer. The resulting lysate was centrifuged at 9,000 × g for 20 min at 4°C (Al-Mariri et al., 2001). P39 was then purified based on metal chelate affinity chromatography as described previously (Letesson et al., 1997).
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0001237
  • Description: The adjuvant is a synthetic phosphorothioate oligodeoxynucleotide containing an unmethylated, consensus immunostimulatory CpG motif (5′-purine-purine-CpG-pyrimidine-pyrimidine-3′ oligodeoxynucleotide [CpG ODN]). Specifically, the immunostimulatory CpG 1826 (5′-TCCATGACGTTCCTGACGTT-3′) was used (Al-Mariri et al., 2001).
• Preparation: The bfr gene of Brucella melitensis 16M was subcloned and expressed in an expression vector. The protein was purified and mixed with the CpG ODN as the vaccine (Al-Mariri et al., 2001).
• Virulence: Not reported.
• Description: P39 has been found to be a Brucella protective antigen (Al-Mariri et al., 2001).

• Vaccine Ontology ID: VO_0000300
• Type: attenuated live vaccine
• Preparation: VTRM1 was obtained from B. melitensis 16M by allelic exchange of the rfbU gene encoding mannosyltransferase with a Tn5-disrupted rfbU gene (Winter et al., 1996).
• Virulence: VTRM1, like RB51, is a stable rough form of B. melitensis that does not revert during passage in mice (Winter et al., 1996).
• Description: Vaccination with the rough strain VTRM1 induces protection against virulent strains of B. abortus (2308), B melitensis (16M), B. suis biovar 1 (750), B. suis biovar 4 (2579), and B. ovis (Winter et al., 1996).

• Vaccine Ontology ID: VO_0000710
• Type: Attenuated live vaccine
• Status: Licensed
• Antigen: Rev.1 is a live attenuated Brucella melitensis strain derived from a virulent B. melitensis isolate.
• RpsL gene engineering:
  • Type: Recombinant protein preparation
  • Description: The gene rpsL of B. melitensis reference strain 16 M encodes for ribosomal protein S12. This gene was mutated in the vaccine strain Rev. 1 during its natural selection process. Nucleotide sequencing has revealed that a mutation in the rpsL gene of vaccine strain Rev . 1 compared to that of reference strain 16M leading to an amino acid Pro- to -Leu change at codon position 91 ( Pro91Leu ) (Cloeckaert et al., 2002).
  • Detailed Gene Information: Click Here.
• Preparation: Rev . 1 vaccine, obtained in the 1950s by a two-step selection involving firstly, a streptomycin resistance and/or dependence, and secondly, a reversion of dependence but maintaining streptomycin resistance (ELBERG and FAUNCE, 1957). Acquired chromosomal streptomycin resistance is frequently due to mutations in the gene encoding for ribosomal protein S12, rpsL (Cloeckaert et al., 2002).
• Virulence: Whether Rev. 1 is virulent is unclear. A Rev. 1-like strain was isolated from the membranes of an aborted fetus at an intensively managed farm that had complied with the vaccination regimen, i.e. ewelambs were vaccinated between two and six months. When the whole flock (410 ewes) was serologically tested, 34 animals showed a positive complement fixation test. The ewes were slaughtered and attempts to culture additional isolates from milk, major lymph nodes, and mammary glands were unsuccessful. A few months later , the flock owner contracted brucellosis and Brucella was cultured from his blood (Banai, 2002).
• Storage: The vaccine was kept on plates at 5 degrees celsius (ELBERG and FAUNCE, 1957).
• Description: The live attenuated strain of B melitensis Rev . 1 is considered the best vaccine available for the prophylaxis of brucellosis in sheep and goats (Cloeckaert et al., 2002).

• Vaccine Ontology ID: VO_0000345
• Type: Live, attenuated vaccine
• Antigen: This vaccine is an live, attenuated purine-auxotrophic mutant strain of Brucella meletensis, WR201 (Hoover et al., 1999).
• purK gene engineering:
  • Type: Recombinant protein preparation
  • Description: The B. melitensis strain WR201 (or called delta purE201) was created through the deletion of the gene purE and the deletion of the first seven bases of purK (Drazek et al., 1995; Hoover et al., 1999). Specifically, B. melitensis 16M was electroporated with suicide plasmids containing a kanamycin resistance cassette that replaced 226 bp at the carboxyl end of purE, the intergenic region, and 18 bases of the purK open reading frame. Recombinant B. melitensis delta purE201 required exogenous purines for growth on minimal media. This mutant failed to grow in human monocyte-derived macrophages, while the growth of wild-type 16M and the complemented strain, delta purE201 (pSD5), increased by nearly two logs (Drazek et al., 1995).
  • Detailed Gene Information: Click Here.
• purE gene engineering:
  • Type: Gene mutation
  • Description: This purE mutant is from Brucella melitensis (Crawford et al., 1996).
  • Detailed Gene Information: Click Here.
• Preparation: The WR201 strain was procured and the bacterial cells were killed by treatment for 16 h with 0.5% phenol. These cells were then washed and pelleted several times, eventually leading to a product containing approximately 3.0 mg of protein per ml (Hoover et al., 1999).
• Virulence: The antigens for this vaccine were severely attenuated. The strain WR201 fails to replicate in cultured human monocyte-derived macrophages (Hoover et al., 1999).

• Vaccine Ontology ID: VO_0000303
• Type: Attenuated live vaccine
• Preparation: The rough mutant VTRS1 was obtained from B. suis 2579 by allelic exchange of the rfbU gene encoding mannosyltransferase with a Tn5-disrupted rfbU gene (Winter et al., 1996).
• Virulence: VTRS1, like RB51, is a stable rough form of the bacterium. It does not manifest evidence of reversion during passage in mice (Winter et al., 1996).
• Description: Vaccination with the rough strain VTRS1 induces protection against virulent strains of B. abortus (2308), B melitensis (16M), B. suis biovar 1 (750), B. suis biovar 4 (2579) (Winter et al., 1996).

• Vaccine Ontology ID: VO_0000347
• Type: Live, attenuated vaccine
• Antigen: The antigen for this vaccine is a bacA deletion mutant of Brucella abortus, known as KL7 (bacAmut-KL7) (Parent et al., 2007).
• Preparation: The bacA mutant strain designated as bacAmut-KL7 was produced by deleting a portion of the bacA gene from the parent strain, B. abortus 2308. The vaccines were produced, each dose containing 5 × 10^4 bacterial colony forming units per dose (Parent et al., 2007).

• Vaccine Ontology ID: VO_0002812
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• exsA gene engineering:
  • Type: Gene mutation
  • Description: This exsA mutant is from Brucella abortus (Rosinha et al., 2002a).
  • Detailed Gene Information: Click Here.
• Immunization Route: Intraperitoneal injection (i.p.)

• Vaccine Ontology ID: VO_0002818
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• pgk gene engineering:
  • Type: Gene mutation
  • Description: This pgk mutant is from Brucella abortus strain 2308 (Trant et al., 2010).
  • Detailed Gene Information: Click Here.
• Immunization Route: Intraperitoneal injection (i.p.)

• Vaccine Ontology ID: VO_0002819
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• pgm gene engineering:
  • Type: Gene mutation
  • Description: This pgm mutant is from Brucella abortus (Ugalde et al., 2003).
  • Detailed Gene Information: Click Here.
• Immunization Route: Intraperitoneal injection (i.p.)

• Vaccine Ontology ID: VO_0004283
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• vjbR gene engineering:
  • Type: Gene mutation
  • Description: The vjbR was mutated in Brucella abortus strain 19 (Arenas-Gamboa et al., 2009).
  • Detailed Gene Information: Click Here.
• Immunization Route: Intraperitoneal injection (i.p.)

• Vaccine Ontology ID: VO_0001144
• Type: DNA vaccine
• Antigen: Brucella outer membrane protein and lumazine synthase from Brucella spp. (BLS) (Cassataro et al., 2007).
• Vector: pCI-neo (Cassataro et al., 2007)
• Preparation: To develop the chimerical plasmid, the BLSOmp31 DNA sequence was amplified by PCR using pETBLSOmp31 as template and sub-cloned in the pCI-neo vector (Promega, Madison, WI). The following oligonucleotides were constructed including restriction sites at the 5
• Virulence: None.
• Description: Brucella outer membrane protein and lumazine synthase from Brucella spp. (BLS) induce protection against Brucella spp. A novel mode of delivering these antigens was devised as a DNA vaccine (Cassataro et al., 2007).

• Vaccine Ontology ID: VO_0004000
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• bp26 gene engineering:
  • Type: Gene mutation
  • Description: This bp26 mutant is from Brucella melitensis (Cloeckaert et al., 2004).
  • Detailed Gene Information: Click Here.
• Immunization Route: subcutaneous injection

• Vaccine Ontology ID: VO_0004277
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: mouse
• mucR gene engineering:
  • Type: Gene mutation
  • Description: This gene is mutated in the B. melitensis 16M mucR mutant (Arenas-Gamboa et al., 2011).
  • Detailed Gene Information: Click Here.
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0004001
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• Omp25 gene engineering:
  • Type: Gene mutation
  • Description: This omp25 mutant is from Brucella melitensis (Edmonds et al., 2002).
  • Detailed Gene Information: Click Here.
• Immunization Route: Intravenous injection (i.v.)

• Vaccine Ontology ID: VO_0004002
• Type: Live, attenuated vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• omp31 gene engineering:
  • Type: Gene mutation
  • Description: This omp31 mutant is from Brucella melitensis (Cloeckaert et al., 2004).
  • Detailed Gene Information: Click Here.
• Immunization Route: subcutaneous injection

• Vaccine Ontology ID: VO_0004146
• Type: Subunit vaccine
• Antigen: A high hydrophobic antigenic complex taken from Brucella ovis (HS) (Estevan et al., 2006).
• Adjuvant:
  • VO ID: VO_0000181
• Preparation: The antigenic extract (HS) was obtained from B. ovis REO 198 cells. The bacterial cells were cultured, suspended in distilled water, and heat-killed in flowing steam. Following centrifugation, the supernatant was dialyzed against deionized water. The dialyzed material was ultracentrifuged, and the pellet (HS) was washed in dH₂O and freeze-dried. The batch of antigen used to prepare the vaccine formulation contained 48.7 ± 5.0% protein and 41.7 ± 4.7% rough lipopolysaccharide (R-LPS). The vaccine consisted of F68–CD–MP microparticles suspended in saline. F68,CD, and MP are different excipients that were used in order to facilitate the encapsulation and conserve the bioactivity of the encapsulated antigenic complex (HS) (Estevan et al., 2006).

• Vaccine Ontology ID: VO_0000358
• Type: Subunit vaccine
• Status: Research
• Antigen: The antigen for this vaccine is SurA protein from B. abortus strain 2308, B. abortus strain S19, and Brucella melitensis strain H38 (Delpino et al., 2007).
• SurA gene engineering:
  • Type: Recombinant protein preparation
  • Description: Mice given rSurA with adjuvant exhibited a significant degree of protection against B. abortus infection (Delpino et al., 2007b).
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0000139
  • Description: Two different adjuvants were used in these vaccines: Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). CFA was administered on day 0 and IFA was administered on day 15 (Delpino et al., 2007).
• Adjuvant:
  • VO ID: VO_0000142
  • Description: Two different adjuvants were used in these vaccines: Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). CFA was administered on day 0 and IFA was administered on day 15 (Delpino et al., 2007).
• Preparation: The PCR primers for cloning SurA gene from B. abortus were as follows: sense 5′AGAAAGCATATGTTTGCAAGACCTCTT3′ (NdeI) and antisense 5′TCTTCGGGATCCTCAACGATTGACGATGGT3′ (BamHI). B. abortus genomic DNA was used as template for PCR with Pfu DNA polymerase (Stratagene). The surA gene was cloned to plasmid Pet17b and then transformed to E. coli JM19 and then BL21(DE3) competent cells. Recombinant proteins were adsorbed with Sepharose-polymyxin B (Sigma, St. Louis, MO) to eliminate lipopolysaccharide contamination. The antigen and PBS were administered mixed with Complete Freund's Adjuvant (CFA) (Sigma) on day 0 and with Incomplete Freund's Adjuvant (IFA) on day 15 (Delpino et al., 2007).
• Immunization Route: Nasal spray, Intraperitoneal injection (i.p.)

• Vaccine Ontology ID: VO_0000374
• Type: DNA vaccine
• Antigen: Brucella abortus L7/L12 protein and Omp16 protein were the antigens used in this vaccine. The vaccine was designated as pcDNA3.1-L7/L12-Omp16 (Luo et al., 2006b).
  divalent fusion DNA vaccine encoding both the Brucella abortus L7/L12 protein (ribosomal protein) and Omp16 protein (outer membrane lipoprotein), designated pcDNA3.1-L7/L12-Omp16.
• L7/L12 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• omp16 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• Vector: pcDNA3.1(+) (Luo et al., 2006b)
• Preparation: Full-length open reading frames of the L7/L12 gene and Omp16 gene were amplified with PCR from the genome of B. abortus strain RB51. The gene amplified with L7/L12 primers and/or the gene amplified with Omp16 primers were inserted into pcDNA3.1(+) vector (Invitrogen) (Luo et al., 2006b).

• Vaccine Ontology ID: VO_0000423
• Type: Subunit vaccine
• Antigen: The vaccine antigen is Brucella L7/L12 protein, which was delivered by an E. coli lipid liposome (escheriosome)-mediated cytosolic delivery system (Mallick et al., 2007).
• Adjuvant:
  • VO ID: VO_0000139
• Preparation: The rL7/L12 proteins were purified and introduced into Escherischia coli lipid liposome, allowing for escheriosome-mediated cytosolic delivery of the antigen, recombinant rL7/L12 protein. Combinations containing rL7/L12 protein and different adjuvants were formed for vaccination (Mallick et al., 2007).

• Vaccine Ontology ID: VO_0000386
• Type: Live, attenuated vaccine
• Antigen: The antigen for this vaccine is live, attenuated B. abortus strain 2308 with a znuA knockout mutation (Yang et al., 2006).
• znuA gene engineering:
  • Type: Gene mutation
  • Description: A suicide plasmid and a B. abortus mutant were constructed, then plasmids from transformants were isolated and analyzed by agarose gel electrophoresis after restriction digestion. B. abortus ΔznuA was electroporated with pBznuA to finalize the mutation (Yang et al., 2006).
  • Detailed Gene Information: Click Here.
• Preparation: ΔznuA mutant, RB51strains were grown overnight in Brucella broth at 37°C. Cells were pelleted, washed twice in sterile phosphate-buffered saline, and diluted to 1 × 10^8 cells/200 μl in sterile PBS. The actual viable inoculum CFU was confirmed by serial dilution tests on Bacto Potato Infusion Agar. Each vaccine consisted of 0.2 ml of this suspension (Yang et al., 2006).
• Virulence: The znuA-deleted mutant is very attenuated (Yang et al., 2006).

• Vaccine Ontology ID: VO_0000398
• Type: Live, attenuated vaccine
• Antigen: An attenuated mutant of Brucella meletensis called vjbR::Tn5 (BMEII1116) is the antigen used in this vaccine (Arenas-Gamboa et al., 2008).
• VjbR gene engineering:
  • Type: Gene mutation
  • Description: Live B. melitensis attenuated mutant vjbR::Tn5 was generated by mutation of the vjbR gene through interruption with a Tn5 (Arenas-Gamboa et al., 2008).
  • Detailed Gene Information: Click Here.
• Preparation: 6 x 10^6 CFU of the live B. melitensis mutant bjvR::Tn5 was suspended in 1ml of MOPS buffer (buffer containing MOPS and NaCl) and mixed with 5 ml of alginate solution. Spheres were obtained by extruding the suspension through a 200 micron nozzle into a 100 mM calcium chloride solution and stirred for 15 minutes. After extrusion of the bacteria-alginate mixture into the CaCl2, the capsules were washed twice with MOPS for 5 minutes and further crosslinked with 0.05% poly-L-lysine for 10 minutes. Following two successive washes, the beads were stirred for five minutes in a solution of 0.03% (w/v) alginate to apply a final outer shell and washed twice with MOPS (Arenas-Gamboa et al., 2008).
• Virulence: B. melitensis mutant bjvR::Tn5 is an attenuated live strain.
• Storage: The vaccine was stored at 4°C (Arenas-Gamboa et al., 2008).

• Product Name: Brucella vaccine using nonpathogenic alphaproteobacteria
• Vaccine Ontology ID: VO_0000450
• Type: Inactivated or "killed" vaccine
• Antigen: The angtiens for this vaccine were Ochrobactrum anthropi, Sinorhizobium meliloti, Mesorhizobium loti, Agrobacterium tumefaciens, or Brucella melitensis H38. These were used because provious findings indicate that Brucella antigens and those from Nonpathogenic Alphaproteobacteria (NPAP) are cross-recognized by the immune system (Delpino et al., 2007a).
• Adjuvant:
  • VO ID: VO_0000133
• Preparation: Bacterial cultures were grown on plates, then centrifuged at 15,000 x g. Bacterial pellets were washed with PBS, then the bacteria were heat-killed. These suspensions were centrifuged at 15,000 x g again, then washed with Tris buffer. The cells were suspended in Tris buffer , then disrupted with a French press. Bacterial cells were broken by two passages and then digested for 1 hour with D. Nase and R. Nase. Unbroken cells were seperated by centrifugation. Particulate matter was pelleted by centrifugation, and the resulting supernatent was stored for vaccine (Delpino et al., 2007a).
  
• Virulence: Not noted.

• Vaccine Ontology ID: VO_0000403
• Type: Subunit vaccine
• Antigen: The antigen for this vaccine is a complex of porin and smooth lipopolysaccharide (S-LPS) extracted from virulent Brucella abortus 2308 (Winter et al., 1988).
• Adjuvant:
  • VO ID: VO_0001250
  • Description: The porin-S-LPS was given without adjuvant or in several adjuvants: trehalose dimycolate and muramyl dipeptide; the pluronic polymer L-121 and muramyl dipeptide; or complexed with Quil A in immunostimulating complexes (Winter et al., 1988).
• Preparation: The S-LPS was produced from smooth strain 2308 by extraction in hot phenol followed by treatment with guanidinium thiocyanate. Inocula were prepared from a freshly thawed vial which was diluted in sterile phosphate buffered saline to yield an infecting dose of 5 x 10^4 bacteria per 0.1 ml. Each dose was mixed with its appropriate adjuvant (Winter et al., 1988).

• Vaccine Ontology ID: VO_0000720
• Type: Live attenuated B. abortus strain
• SodC from B. abortus strain 2308 gene engineering:
  • Type: Protein overexpression
  • Description: B. abortus Cu/Zn SOD is over-expressed in recombinant strain RB51SOD using the broad-range plasmid pBBR1MCS (Vemulapalli et al., 2000a).
  • Detailed Gene Information: Click Here.
• Preparation: The gene for B. abortus Cu/Zn SOD (sodC) along with its own promoter was initially obtained from a genomic library of B. abortus strain 2308, and later subcloned into pBBR1MCS, a broad-host-range plasmid. The resulting plasmid pBBSOD was transformed into E. coli DH5a, confirmed, purified, and then electroporated into B. abortus strain RB51. Strain RB51 containing the plasmid pBBSOD was designated RB51SOD (Vemulapalli et al., 2000a).
• Virulence: RB51SOD is not more virulent than RB51 (Vemulapalli et al., 2004).
• Storage: RB51SOD does not increase virulence compared to RB51.
• Description: RB51SOD is a recombinant strain of B. abortus cattle vaccine strain RB51. RB51SOD overexpresses B. abortus Cu/Zn superoxide dismutase (SOD). Overexpression of this enzyme significantly increases vaccine efficacy against strain 2308 challenge (Vemulapalli et al., 2004).

• Vaccine Ontology ID: VO_0000404
• Type: Live attenuated B. abortus strain
• Preparation: RB51WboA is a recombinant Brucella strain that complements RB51 with a functional wboA gene. Rough Brucella abortus RB51 is a stable, attenuated mutant vaccine generated strain derived from virulent strain 2308. The wboA gene in RB51 is disrupted by an IS711 element. Abrogation of the wboA gene in smooth , virulent B. abortus, B. melitensis , and B. suis results in rough , attenuated mutants which fail to produce O polysaccharide (O antigen) (Vemulapalli et al., 2000).
• Virulence: RB51WboA is not more virulent than RB51 (Vemulapalli et al., 2000b).

• Vaccine Ontology ID: VO_0000373
• Type: Subunit vaccine
• Antigen: The antigen for this vaccine is rDnaK protein from B. abortus strain 2308, B. abortus strain S19, and Brucella melitensis strain H38 (Delpino et al., 2007).
• Adjuvant:
  • VO ID: VO_0000139
  • Description: Two different adjuvants were used in these vaccines: Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). CFA was administered on day 0 and IFA was administered on day 15 (Delpino et al., 2007).
• Adjuvant:
  • VO ID: VO_0000142
  • Description: Two different adjuvants were used in these vaccines: Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). CFA was administered on day 0 and IFA was administered on day 15 (Delpino et al., 2007).
• Preparation: The open reading frame of DnaK was cloned in the Pet17b vector (Novagen, Madison, WI, USA). The specific primers for B. abortus DnaK contain with XbaI and BamHI restriction sites at the 5′ ends: sense 5′ GCAGTTTCTAGAATGGAGAGAAATA 3′, antisense 5′ TAAAAGGATCCAATTACGACGAC 3′. B. abortus genomic DNA was used as template for PCR with Pfu DNA polymerase (Stratagene). Plasmid Pet17b was digested with BamHI and NheI. After ligation, the mix was used to transform E. coli JM109 competent cells. The plasmid DNA of a clone containing the insert was purified and used to transform E. coli strain BL21 (DE3) competent cells. Upon induction with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG), recombinant DnaK (rDnaK) was successfully expressed, and purified using a Mono Q column in an AKTA apparatus (Amersham Pharmacia, Uppsala, Sweden). Recombinant proteins were adsorbed with Sepharose-polymyxin B (Sigma, St. Louis, MO) to eliminate lipopolysaccharide contamination (Delpino et al., 2007).

• Vaccine Ontology ID: VO_0000413
• Type: Subunit vaccine
• Antigen: The antigen used in this vaccine is a chimerical protein containing parts of Brucella Lumazine Synthase (BLS) and an outer membrane protein of 31 kDa (Omp31).
• Preparation: Recombinant BLS (rBLS), rOmp31 and rBLSOmp31 were expressed in E. coli and purified as previously described (Laplagne et al., 2004). Purity was assessed by Coomassie blue stain, and recombinant proteins were adsorbed with Sepharose-polymyxin B to eliminate LPS contamination. The peptide was further purified by HPLC using a C-18 reverse phase column and the molecular weight was confirmed by mass spectroscopy (Laplagne et al., 2004).
• Virulence: None.
• Description: The chimerical protein BLSOmp31 is synthesized using parts of Brucella Lumazine Synthase (BLS) and an outer membrane protein of 31 kDa (Omp31), which have given limited protection in mouse models (Cassataro et al., 2007).

• Vaccine Ontology ID: VO_0000407
• Type: Recombinant vector vaccine
• Adjuvant:
  • VO ID: VO_0001237
• Preparation: Ochrobactrum anthropi strain 47237 was originally isolated from soil. Plasmids pBBSOD and pBBR1MCS were electroporated into electrocompetent O. anthropi strain 49237 using a protocol described previously for Brucella. Colonies of the O. anthropi strain 49237 containing pBBSOD or pBBR1MCS (designated O. anthropi strain 49237SOD or 49237pBB, respectively) were selected from TSA plates containing chloramphenicol at a concentration of 30 μg/ml (He et al., 2002)
• Virulence: O. anthropi strains are rarely pathogenic to humans (He et al., 2002)
• Description: Ochrobactrum anthropi is very closely related to Brucella, and has been used as a vaccine or vaccine vector for Brucellosis (He et al., 2002).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Groups of four or five female 6- to 8-week-old BALB/c mice were vaccinated via i.p. injection of 1 × 10^6 CFU/ml of unmarked deletion mutant or PBS for naïve controls (Kahl-McDonagh et al., 2007).
• Persistence: Mice receiving a dose of 5 × 10^7 CFU/ml had lung colonization with B. abortus strain 2308 that gradually increased over the first 4 weeks postchallenge, then gradually decreased over the following 4 weeks to 90% of the maximum value. Despite this slight decrease, colonization by the organism in the other tissues was consistent with a chronic infection. Colonization of the liver, although barely detectable at 1 week postchallenge, steadily increased over the first 4 weeks postchallenge and then declined negligibly between weeks 4 and 8. The spleens of infected mice displayed a colonization pattern similar to that of the livers, although the total number of CFU recovered was consistently higher. Spleen colonization increased between weeks 4 and 8, consistent with a persistent infection (Kahl-McDonagh et al., 2007).
• Side Effects: Mice receiving a dose of 5 × 10^7 CFU/ml had lung colonization with 2308 that gradually increased over the first 4 weeks postchallenge, then gradually decreased over the following 4 weeks to 90% of the maximum value. Despite this slight decrease, colonization by the organism in the other tissues was consistent with a chronic infection. Colonization of the liver, although barely detectable at 1 week postchallenge, steadily increased over the first 4 weeks postchallenge and then declined negligibly between weeks 4 and 8. The spleens of infected mice displayed a colonization pattern similar to that of the livers, although the total number of CFU recovered was consistently higher. Spleen colonization increased between weeks 4 and 8, consistent with a persistent infection (Kahl-McDonagh et al., 2007).
• Challenge Protocol: BALB/c mice were challenged with an aerosol chamber dose of 5 × 10^9 CFU/ml of the homologous wild-type strain at 20 weeks postvaccination. Four weeks after the virulent challenge (corresponding to 24 weeks postvaccination), the mice were euthanized and the recovery of the challenge orgainsm was measured (Kahl-McDonagh et al., 2007).
• Efficacy: The bacterial burden in the spleen following aerosol challenge was reduced 2.02 U by vaccination with BAΔasp24 and by 0.86 U by vaccination with BAΔvirB2 relative to the burden in naïve mice. The rough BAΔmanBA mutant was unable to elicit significant protective immunity relative to the immunity of naïve mice. At 24 weeks postvaccination, less protection was observed in the lungs of mice vaccinated with BAΔasp24 and BAΔvirB2, although the protection was significantly greater than that observed for naïve controls. The rough mutant, BAΔmanBA, protected mouse lungs to a lesser degree, which was not significant(Kahl-McDonagh et al., 2007) .

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: The mice were anesthetized with methoxyflurane (Metofan; Mallinckrodt) and inoculated intramuscularly with 100 μg of pcDNA3.1-L7/L12-Omp16, pcDNA3.1-L7/L12, or pcDNA3.1-Omp16 in 100 μl of PBS (50 μl of the solution was injected into each tibialis anterior muscle). The control mice were infected with PBS or the expression vector alone (pcDNA3.1). Each mouse in another group was injected with 10 μg of rL7/L12-Omp16 in 100 μl PBS according to the same schedule. Each mouse was injected on weeks 0, 2, and 4. The mice used as positive controls were inoculated intraperitoneally on day 0 with 2× 10^8 CFU of B. abortus strain RB51 in 0.2 ml of PBS (Luo et al., 2006b).
• Challenge Protocol: Two weeks after the final vaccination, five mice from each group were challenged intraperitoneally with relatively higher dose of strain 544 (5 × 10^5 CFU). Four weeks postchallenge, the mice were killed by cervical dislocation, and their spleens were removed aseptically and weighed (Luo et al., 2006b).
• Efficacy: This divalent DNA vaccine induced a significant level of protection against challenge with the virulent B. abortus in BALB/c mice (Luo et al., 2006b).
• Host Ighg1 response
  • Description: Sera collected 2 weeks after the last immunization were assayed for the presence of L7/L12- and/or Omp16-specific antibodies by ELISA. The pcDNA 3.1-L7/L12-OMP16 vaccine elicited significantly higher levels of IgG1 antibodies than did the negative control vaccine, pcDNA 3.1 (Luo et al., 2006b).
  • Detailed Gene Information: Click Here.
• Host Ighv1-9 response
  • Description: Sera collected 2 weeks after the last immunization were assayed for the presence of L7/L12- and/or Omp16-specific antibodies by ELISA. The pcDNA 3.1-L7/L12-OMP16 vaccine elicited significantly higher levels of IgG2a antibodies than did the negative control vaccine, pcDNA 3.1 (Luo et al., 2006b).
  • Detailed Gene Information: Click Here.

Mouse Response

• Vaccination Protocol: Plasmids carrying BCSP31, SOD, and L7/L12 genes were administered by intramuscular injection of 150 ug DNA (50 ug of each plasmid) in 150 uL saline solution into each of the quadriceps. For the vector control group, 150 mg pJW4303 empty vector DNA in 150 mL saline was used for injection. As an additional negative control, mice were injected with 150 mL saline. Immunization of mice was repeated thrice at 3-week intervals. The positive control group of mice was vaccinated intraperitoneally with 5x10^6 colony-forming units (CFU) of B. abortus
• Immune Response: Mice vaccinated with the combined DNA produced a rapid and specific IgG response 3 weeks after the initial vaccination, and peak titers were detected 3 weeks after the last immunization. The S19-vaccinated mice also induced antibody production, but the rise was not as pronounced. Combined DNA–vaccinated mice had significantly higher BCSP31-, SOD-, L7/L12-, and Brucella-specific total IgG production than S19-vaccinated mice. Combined DNA–vaccinated mice produced significantly higher levels of IFN-g and TNF-a ( p < 0.01) compared with the two negative control groups. A significant T cell response was observed after incubating spleen cells from combined DNA–vaccinated mice with the specific antigens rBCSP31, rSOD, rL7/L12, and heat-killed B. abortus (Yu et al., 2007).
• Challenge Protocol: Mice were challenged intravenously with 5x10^6 CFU (Yu et al., 2007).
• Efficacy: The levels of infection were evaluated by measuring CFU in the spleen. The combined DNA–vaccinated mice displayed a significantly higher level of protection than mice vaccinated with vector DNA or saline (3.58 log units higher; p < 0.001; n=10). In addition, our vaccine provided significantly higher protection than S19 (log units=2.87 for S19; p=0.034); that is, after infection, the number of CFU in the spleen of the combined DNA vaccine group was reduced to less than 20% of that in the S19 group. Indicating that the combined DNA vaccine affords a significant degree of protection against Brucella infection (Yu et al., 2007).

Mouse Response

• Host Strain: BALB/c mice
• Vaccination Protocol: Mice premedicated with atropine (16 µg/mouse) were anesthetized with ketamine (2 µg/mouse), their abdominal regions shaved. One 3-mm-long incision was made through the skin. The mice were injected in the spleen with 10 µg of plasmid DNA in 30 µl of PBS. Mice were injected i.m. in the right tibialis anterior muscle with 10 µg of plasmid DNA per mouse. The mice were vaccinated once with pcDNA-SOD construct or with pcDNA3 as a negative control. For protection assays, an additional group was inoculated with PBS as a negative control (Munoz-Montesino et al., 2004).
• Immune Response: Animals vaccinated with pcDNA-SOD did not develop SOD-specific antibodies, at least until week 4 after immunization (the end of the experiment), and in vitro stimulation of their splenocytes with either recombinant Cu-Zn SOD or crude Brucella protein induced the secretion of gamma interferon (IFN-γ), but not interleukin-4, and elicited the induction of cytotoxic-T-lymphocyte activity. Upon analyzing the SOD-specific T-cell responses, the pcDNA-SOD vaccination was found to be stimulating both CD4+- and CD8+-T-cell populations. However, only the CD4+ population was able to produce IFN-γ and only the CD8+ population was able to induce cytotoxic activity (Munoz-Montesino et al., 2004).
• Challenge Protocol: Four weeks after vaccination, six mice from each group were challenged by intraperitoneal injection of 10^4 CFU of B. abortus 2308. Two weeks later, the infected mice were sacrificed, their spleens homogenized, and dilutions of the extract were plated to determine the number of Brucella CFU per spleen (Munoz-Montesino et al., 2004).
• Efficacy: Immunization (i.s.) with pcDNA-SOD induced a significant degree of protection (1.52-log-unit increase in protection) compared to the control group (P < 0.008). The mice that were immunized (i.m.) with pcDNA-SOD showed minimal protection, (P < 0.2). No significant difference was seen between the CFU numbers in control groups injected with pcDNA3 and PBS. Vaccination with pcDNA-SOD vaccination (i.s.) therefore provided a significant degree of protection against Brucella infection (Munoz-Montesino et al., 2004).
• Host Ifng (Interferon gamma) response
  • Description: pcDNA-SOD induced Cu-Zn SOD specific IFN-γ production from CD4+ but not CD8+ T cells from in pcDNA-SOD immunized mice (Munoz-Montesino et al., 2004).
  • Detailed Gene Information: Click Here.
• Host Il4 (interleukin 4) response
  • Description: pcDNA-SOD did not induce interleukin-4 production in immunized mice (Munoz-Montesino et al., 2004).
  • Detailed Gene Information: Click Here.

Mouse Response

• Vaccine Immune Response Type: VO_0000286
• Immune Response: Vaccination was able to induce a broad range of immune responses including antibody production, CD8+ cytotoxic T cells (CTLs), and CD4+ T helper cell activation (Onate et al., 2003).
• Efficacy: Immunization with pcDNA-SOD resulted in a significantly higher degree of protection (2.16 log increase in protection) compared to the unimmunized control groups (P < 0.0005). The level of protection was similar to the one induced by B. abortus vaccine strain RB51. Thus, pcDNA-SOD vaccine afforded a significant degree of protection against Brucella infection (Onate et al., 2003).

Mouse Response

• Vaccine Immune Response Type: VO_0000286
• Immune Response: Inoculation of plasmid DNA containing the L7/L12-P39 gene leads to both TH1 type antibody and CMI responses (Luo et al., 2006a).
• Efficacy: Among the three DNA vaccines (including pcDNA3.1(+)-L7/L12 and pcDNA3.1(+)-P39), the pcDNA3.1 (+)-L7/L12-P39 DNA vaccine could provide the highest protective level against Brucella infection, as it confers protection against A544 challenge (Luo et al., 2006a).

Mouse Response

• Vaccine Immune Response Type: VO_0003057
• Immune Response: Mice injected with pVF278 had a dominant immunoglobulin G2a (IgG2a) response and elicited a T-cell-proliferative response (Sislema-Egas et al., 2012).
• Efficacy: Data from two independent protection experiments demonstrated that immunization with pVF278 DNA vaccine resulted in a significantly degree of protection (1.28 log increase in protection) with P < 0.05 after determination of CFU in the spleen (Sislema-Egas et al., 2012).

Mouse Response

• Vaccine Immune Response Type: VO_0000286
• Efficacy: Two independent protection experiments demonstrated that mice given pcDNA-BLS had a significantly higher degree of protection (1.65 log increase in protection) than did controls receiving PBS (P < 0.01) (Velikovsky et al., 2002).

Mouse Response

• Vaccination Protocol: Mice (10/treatment group) were injected i.p. with 0.2 ml of a 0.15 M NaCl saline solution (controls) or with 0.2 ml of saline containing approximately 1x10^5 cfu of strain 2308 or 1x10^7 cfu of strain 19 or RB51. Blood samples and spleens were taken from age-matched noninfected control mice and from infected mice at 2, 4, 6, 10, or 20 weeks respectively after infection (Stevens et al., 1994b).
• Challenge Protocol: No challenge performed.

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Five groups of 15 BALB/c mice were immunized intraperitoeally with 0.2 ml of the following treatments: either phosphate-buffered saline (PBS); Immuneplus adjuvant system; adjuvant containing 75 micrograms of maltose binding protein (MBP); 4 adjuvant containing 100 micrograms of MBP-L7/L12 fusion protein; or B. abortus strain 19 (Oliveira et al., 1996).
• Immune Response: There was a specific antibody response from animals immunized with recombinant MBP-L7/L12 fusion protein. Serum samples from mice immunized with MBP-L7/L12 contained anti-MBP and anti-L7/L12 antibodies. No anti-MBP-L7/L12 antibodies were detected in the sera of naive mice used as a negative control (Oliveira et al., 1996).
• Challenge Protocol: Mice were challenged one week after their final immunization (day 28) with an i.v. injection of 1 x 10^6 c.f.u. B. abortus in 100 microliters of sterile phosphate buffer saline (Oliveira et al., 1996).
• Efficacy: Three immunizations with 100 micrograms of the recombinant L7/L12 ribosomal protein fused to MBP protected mice against B. abortus infection, while vaccination with 75 micrograms of MBP alone resulted in no protection. The recombinant L7/L12 protein engendered substantial protective immunity to BALB/c mice against challenge when compared to the protection levels conferred to mice vaccinated with B. abortus S19. The greatest levels of protection observed in immunized mice were at 2 and 4 weeks post-challenge (Oliveira et al., 1996). The irrelevant Escherichia coli protein (MBP) does not protect mice against brucellosis (Oliveira et al., 1996).

Mouse Response

• Host Strain: BALB/C
• Vaccination Protocol: Three intra-muscular vaccinations of DNA vaccine encoding L7/L12 protein at 3 week intervals.(Abtahi et al., 2008)
• Immune Response: Activation of Th1 cell response. (Abtahi et al., 2008)
• Efficacy: Lower bacterial cfu from vaccinated mice in comparison with control groups show the efficiency of L7/L12 DNA vaccination in mice model. (Abtahi et al., 2008)
• Host Ifng (Interferon gamma) response
  • Description: Splenic lymphocytes from L7/L12pCDNA3-vaccinated mice produced high levels of IFNy (3100 pg mL(-1)) 3 weeks post-vaccination. (Abtahi et al., 2008)
  • Detailed Gene Information: Click Here.
• Host Ighg1 response
  • Description: IgG1 titers induced post-immunization with L7/L12pCDNA3 vaccine. (Abtahi et al., 2008)
  • Detailed Gene Information: Click Here.
• Host Ighv1-9 response
  • Description: L7/L12pCDNA3 immunizations elicited high IgG2a isotype response in mice immunized (Abtahi et al., 2008)
  • Detailed Gene Information: Click Here.
• Host Il5 response
  • Description: Splenic lymphocytes from L7/L12pCDNA3-vaccinated mice produced low levels of IL-5 (300 pg mL(-1)) 3 weeks post-vaccination. (Abtahi et al., 2008)
  • Detailed Gene Information: Click Here.

Mouse Response

• Host Strain: BALB/c mice
• Vaccination Protocol: ~4 x 10^8 CFU
• Persistence: Inoculation (ip) of RB51 into mice results in a splenic colonization which is cleared within four weeks post infection. RB51 does not revert to smooth colony morphology upon passage in vivo (mice) or in vitro (Schurig et al., 1991).
• Side Effects: No obvious symptoms were observed in immunized mice.
• Efficacy: The CFU in spleen decreases 1-2 logs.
• Description: Vaccination of mice with RB51 induces specific cytotoxic T lymphocytes (CTLs) against strain RB51 and strain 2308-infected J774.A1 macrophages but not against Listeria monocytogenes-infected J774.A1 cells. Antigen-specific cytotoxic activity is exerted by T lymphocytes but not by NK cells. CD3+ CD4+ T cells secrete the highest level of IFN-γ and induce low but significant level of lysis of Brucella-infected macrophages. In contrast, CD3+ CD8+ T cells secrete low levels of IFN-γ but high levels of specific lysis of Brucella-infected macrophages. No nonspecific lysis was observed. Hence CD3+ CD4+ and CD3+ CD8+ T cells play synergistic roles in anti-Brucella activity (He et al., 2001).
• Host Ifng (Interferon gamma) response
  • Description: IFN-gamma is up-regulated in RB51-immunized mice (He et al., 2001).
  • Detailed Gene Information: Click Here.

Mouse Response

• Host Strain: CD1
• Vaccination Protocol: Four groups of 10 female CD1 mice per group (5-6 weeks old) were vaccinated intraperitoneally (IP) with 3-5 x 10^8 CFU in 100 µl of RB51, RB51leuB, RB51leuB/pNS4, or RB51leuB/pNS4/GFP. Another group of 10 mice were vaccinated with saline to serve as a negative control. Three mice from each group were bled at 5 weeks post-vaccination to harvest serum. The sera were screened for GFP-specific antibodies by immunoblot (Rajasekaran et al., 2008).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	RB51	10	in volume		female	5.5 week	no	Vaccinated intraperitoneally (IP) with 3-5 x 10^8 CFU in 100 µl of RB51. Three mice were bled at 5 weeks post-vaccination to harvest serum, which was screened for GFP-specific antibodies by immunoblot (Rajasekaran et al., 2008).
  2	RB51leuB	10	in volume		female	5.5 week	no	Vaccinated intraperitoneally (IP) with 3-5 x 108 CFU in 100 µl of RB51leuB. Three mice were bled at 5 weeks post-vaccination to harvest serum, which was screened for GFP-specific antibodies by immunoblot (Rajasekaran et al., 2008).
  3	RB51leuB/pNS4	10	in volume		female	5.5 week	no	Vaccinated intraperitoneally (IP) with 3-5 x 10^8 CFU in 100 µl of RB51leuB/pNS4. Three mice were bled at 5 weeks post-vaccination to harvest serum, which was screened for GFP-specific antibodies by immunoblot (Rajasekaran et al., 2008).
  4	RB51leuB/pNS4/GFP	10	in volume		female	5.5 week	no	Vaccinated intraperitoneally (IP) with 3-5 x 10^8 CFU in 100 µl of RB51leuB/pNS4/GFP. Three mice were bled at 5 weeks post-vaccination to harvest serum, which was screened for GFP-specific antibodies by immunoblot (Rajasekaran et al., 2008).
  5	Saline	10	in volume		female	5.5 week	yes	Injected intraperitoneally (IP) with 100 µl of saline to act as negative controls. Three mice were bled at 5 weeks post-vaccination to harvest serum, which was screened for GFP-specific antibodies by immunoblot (Rajasekaran et al., 2008).

• Persistence: Mice vaccinated with the leuB mutant and the complemented RB51leuB strains were able to clear the virulent challenge strain B. abortus 2308 (S2308) at significant rates compared with clearance in the mice vaccinated with saline. No significant difference was observed in the rates of clearance of the challenge strain in the mice vaccinated with auxotrophic vaccine strains and the standard strain RB51 and also between the RB51leuB strains. In a separate experiment, the leuB auxotroph and the complemented leuB auxotroph were found to be cleared from CD1 mouse spleens by 4 to 5 weeks, at the same rate as the parent vaccine strain RB51 (Rajasekaran et al., 2008).
• Challenge Protocol: At 6 weeks post-vaccination, all groups of mice were challenged IP with 4 x 10^4 CFU of B. abortus strain 2308 (S2308). At 2 weeks post-challenge, mice were euthanized by CO2 asphyxiation, and their spleens were recovered, homogenized, serially diluted, and plated on trypticase soy agar (TSA) plates to estimate CFU (Rajasekaran et al., 2008).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	40000 CFU in volume 0.1 ml	Intraperitoneal injection (i.p.)	day	6 week

• Efficacy: The leuB/GFP construction was shown to complement a leucine auxotroph of RB51, which protected CD1 mice from virulent B. abortus 2308 (S2308) and elicited GFP antibodies. The leuB auxotroph and the complemented auxotroph of strain RB51 were able to protect the CD1 mice against an S2308 challenge. There was no significant difference in the protection levels (as measured by splenic clearance) afforded by the leuB auxotroph when the protection levels in the mice vaccinated with the complemented leuB auxotroph and with the complemented leuB auxotroph expressing GFP were compared to the protection level in the mice vaccinated with strain RB51. There was, however, a significant difference in protection afforded between the mice vaccinated with any of the RB51 strains and the saline control. Only sera from the group inoculated with RB51leuB/pNS4/GFP possessed GFP-specific antibodies (Rajasekaran et al., 2008).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	90000 CFU	Each of the RB51 groups (RB51, RB51leuB, RB51leuB/pNS4, and RB51leuB/pNS4GFP) increased clearance by ~ 1 log (10^4 CFU vs. 10^5 CFU for saline control group, so reduction of ~90,000 CFU). However, there was no significant difference (NSD) between groups (Rajasekaran et al., 2008).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: To characterize the optimal aerosol dosage of Brucella abortus strain 2308 (S2308) and B. melitensis (S16M), 10^3–10^10 CFU were nebulized to BALB/c mice. A range of dosages was evaluated to determine optimal dosages for aerosolization. Protection in vaccinated and non-vaccinated mice were compared after experimental B. abortus challenge via IP and aerosol routes. For aerosol delivery, the nebulization apparatus consists of a compressed air tank and a jet nebulizer connected via a rubber hose to a port in a metal cage cover. A flow rate of 2 l/min produces a 5 ml particle size. Compressed air was used to jet nebulize 2 ml of challenge inoculum directly into a plexiglass cage containing 5 mice. Nebulization continued until all inoculum, plus 2 ml saline was delivered over ~15 min.
  Experiment 1: S2308 or S16M were spectrophotometrically adjusted to concentrations between 10^3 and 10^10 CFU and delivered by aerosol to female 10-week-old BALB/c mice. At 2 weeks after nebulization, mice were euthanized with CO2. Spleen, liver, and lung from each mouse were removed and weighed. Tissues were macerated and serially diluted, with standard plate counts used to determine bacterial concentrations.
  Experiment 2: Mice were injected IP with 0.2 ml of saline +/- ~1 x 10^7 CFU of SRB51. At 12 weeks after vaccination, mice were challenged with S2308 IP (0.2 ml saline + 5 x 10^4 CFU) or via nebulization (~10^9 CFU). Two weeks after challenge, mice were euthanized with CO2. Spleens, livers and lungs were weighed and processed for isolation and quantification of Brucella as described in Experiment 1.
  (Olsen et al., 2007)
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	Nebulized S2308 CFU	10	in volume		female	10 week	no	Brucella abortus strain 2308 (S2308) was spectrophotometrically adjusted to concentrations between 10^3 and 10^10 CFU and delivered by aerosol to female 10-week-old BALB/c mice. At 2 weeks after nebulization, mice were euthanized with CO2. Spleen, liver, and lung from each mouse were removed and weighed. Tissues were macerated and serially diluted, with standard plate counts used to determine bacterial concentrations (Olsen et al., 2007).
  2	Nebulized S16M CFU	10	in volume		female	10 week	no	Brucella melitensis strain 16M (S16M) were spectrophotometrically adjusted to concentrations between 10^3 and 10^10 CFU and delivered by aerosol to female 10-week-old BALB/c mice. At 2 weeks after nebulization, mice were euthanized with CO2. Spleen, liver, and lung from each mouse were removed and weighed. Tissues were macerated and serially diluted, with standard plate counts used to determine bacterial concentrations (Olsen et al., 2007).
  3	IP saline vaccine	15	in volume		female	10 week	yes	Control mice were injected IP with 0.2 ml of saline. At 12 weeks after vaccination, mice were challenged with S2308 IP (0.2 ml saline + 5 x 10^4 CFU) or via nebulization (~10^9 CFU). Two weeks after challenge, mice were euthanized with CO2. Spleens, livers and lungs were weighed and processed for isolation and quantification of Brucella as described in Experiment 1 (Olsen et al., 2007).
  4	IP SRB51 vaccine	15	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were injected IP with 0.2 ml of saline containing 10^7 CFU of SRB51. At 12 weeks after vaccination, mice were challenged with S2308 delivered either IP or via nebulization. Two weeks after challenge, mice were euthanized with CO2/O2. Spleens, livers and lungs were weighed and processed for isolation and quantification of Brucella (Olsen et al., 2007).

• Persistence: Total CFU per tissue increased beginning at 10^6–10^7 CFU dosages, with 10^9 CFU appearing to be an optimal dosage for S16M or S2308 aerosol delivery.
  (Olsen et al., 2007)
• Immune Response: (Olsen et al., 2007)
• Side Effects: (Olsen et al., 2007)
• Challenge Protocol: At 12 weeks after vaccination with 10^7 CFU of SRB51 or saline (control), mice were challenged IP with 6.4 x 10^4 CFU or via aerosol (1.76 x 10^9 CFU) with S2308.
  (Olsen et al., 2007)
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	64000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	12 week
  2	S2308	1760000000 CFU in volume 4 ml	nebeulization (aerosol)	day	12 week

• Efficacy: Mice vaccinated with SRB51 had reduced splenic, liver and lung colonization after IP challenge with S2308 as compared with control mice after IP S2308 challenge. Control and SRB51-vaccinated mice did not differ in splenic, liver, or lung colonization after aerosol S2308 challenge.
  (Olsen et al., 2007)
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	2 CFU	Mice vaccinated with SRB51 had reduced splenic (decreased by ~2 CFU/g x tissue weight), liver (decreased by ~3 CFU/g x tissue weight), and lung (decreased by ~5 CFU/g x tissue weight) colonization after IP challenge with S2308 as compared with control mice after IP S2308 challenge. Control and SRB51-vaccinated mice did not differ in splenic, liver, or lung colonization after aerosol S2308 challenge (Olsen et al., 2007).
  2	assay of CFU reduction in liver	3 CFU	Mice vaccinated with SRB51 had reduced splenic (decreased by ~2 CFU/g x tissue weight), liver (decreased by ~3 CFU/g x tissue weight), and lung (decreased by ~5 CFU/g x tissue weight) colonization after IP challenge with S2308 as compared with control mice after IP S2308 challenge. Control and SRB51-vaccinated mice did not differ in splenic, liver, or lung colonization after aerosol S2308 challenge (Olsen et al., 2007).
  3	assay of CFU redcution in lung	5 CFU	Mice vaccinated with SRB51 had reduced splenic (decreased by ~2 CFU/g x tissue weight), liver (decreased by ~3 CFU/g x tissue weight), and lung (decreased by ~5 CFU/g x tissue weight) colonization after IP challenge with S2308 as compared with control mice after IP S2308 challenge. Control and SRB51-vaccinated mice did not differ in splenic, liver, or lung colonization after aerosol S2308 challenge (Olsen et al., 2007).

• Description: (Olsen et al., 2007)

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Investigators evaluated the effect of oral inoculation (PO) of Brucella abortus RB51 in BALB/c female mice against a challenge infection with B. abortus (S)2308. For IP immunization with live bacteria, mice were given 2 x 10^8 CFU of B. abortus RB51 in 0.2 ml of sterile saline or 2 x 10^4 CFU of strain S2308. For PO immunization, a gastric lavage needle was used. Ten minutes prior to oral inoculation, mice were administered 0.2 ml of 10% sodium bicarbonate (NaHCO3) to neutralize gastric acidity or 0.2 ml of sterile saline. Mice were inoculated PO with 2 x 10^10 CFU of RB51 or S2308. On days 10 and 18 after PO RB51 or S2308, preceded or not by gastric acidity neutralization, mice were killed and their spleens removed. Spleens were homogenized in 1 ml of sterile saline. Aliquots of the resulting suspensions were plated to assess spleen colonization.
  In separate experiments, mice were inoculated PO with RB51. Oral inoculation was preceded by gastric acidity neutralization. To evaluate the excretion of bacteria after oral exposure, fecal samples were collected daily for 3 days after inoculation. At 7, 15, 30, and 42 days after infection, mice were bled and killed and spleens were aseptically removed, weighed, homogenized in PBS, and plated to determine the outcome of infection (Pasquali et al., 2003).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	IP RB51	5	in volume		female	13 week	no	For IP immunization with live bacteria, mice were given 2 x 10^8 CFU of Brucella abortus RB51 in 0.2 ml of sterile saline (Pasquali et al., 2003).
  2	IP S2308	5	in volume		female	13 week	no	For IP immunization with live bacteria, mice were given 2 x 10^4 CFU of B. abortus 2308 (Pasquali et al., 2003).
  3	IP saline	5	in volume		female	13 week	yes	For negative control of IP immunization, mice were given 0.2 ml of sterile saline (Pasquali et al., 2003).
  4	PO RB51 + NaHCO3	5	in volume		female	13 week	no	For oral (PO) immunization, a gastric lavage needle was used. Ten minutes prior to oral inoculation, mice were administered 0.2 ml of 10% sodium bicarbonate (NaHCO3) to neutralize gastric acidity. Mice were orally inoculated with 2 x 10^10 CFU of RB51. On days 10 and 18 after PO RB51 or S2308, preceded or not by gastric acidity neutralization, mice were killed and their spleens removed. Spleens were homogenized in 1 ml of sterile saline. Aliquots of the resulting suspensions were plated to assess spleen colonization (Pasquali et al., 2003).
  5	PO RB51 + saline	5	in volume		female	13 week	no	For oral (PO) immunization, a gastric lavage needle was used. Ten minutes prior to oral inoculation, mice were administered 0.2 ml of sterile saline. Mice were orally inoculated with 2 x 10^10 CFU of RB51. On days 10 and 18 after PO RB51 or S2308, preceded or not by gastric acidity neutralization, mice were killed and their spleens removed. Spleens were homogenized in 1 ml of sterile saline. Aliquots of the resulting suspensions were plated to assess spleen colonization (Pasquali et al., 2003).
  6	PO S2308 + NaHCO3	5	in volume		female	13 week	no	For oral (PO) immunization, a gastric lavage needle was used. Ten minutes prior to oral inoculation, mice were administered 0.2 ml of 10% sodium bicarbonate (NaHCO3) to neutralize gastric acidity. Mice were orally inoculated with 2 x 10^10 CFU of S2308. On days 10 and 18 after PO RB51 or S2308, preceded or not by gastric acidity neutralization, mice were killed and their spleens removed. Spleens were homogenized in 1 ml of sterile saline. Aliquots of the resulting suspensions were plated to assess spleen colonization (Pasquali et al., 2003).
  7	PO S2308 + saline	5	in volume		female	13 week	no	For oral (PO) immunization, a gastric lavage needle was used. Ten minutes prior to oral inoculation, mice were administered 0.2 ml of sterile saline. Mice were orally inoculated with 2 x 10^10 CFU of S2308. On days 10 and 18 after PO RB51 or S2308, preceded or not by gastric acidity neutralization, mice were killed and their spleens removed. Spleens were homogenized in 1 ml of sterile saline. Aliquots of the resulting suspensions were plated to assess spleen colonization (Pasquali et al., 2003).
  8	PO saline	5	in volume		female	13 week	yes	For oral (PO) control, a gastric lavage needle was used to inoculate mice with 0.2 ml of sterile saline. On days 10 and 18 after inoculation, mice were killed and their spleens removed. Spleens were homogenized in 1 ml of sterile saline. Aliquots of the resulting suspensions were plated to assess spleen colonization (Pasquali et al., 2003).

• Persistence: Gastric acid neutralization prior to the oral inoculation contributed to a more homogeneous and consistent infection with both RB51 and S2308. Clearance and immune response following oral infection with RB51 was successively assessed. PO inoculation gave a mild infection, which was cleared 42 days later and induced a delayed humoral and cell-mediated immune (CMI) response (Pasquali et al., 2003).
• Immune Response: (Pasquali et al., 2003)
• Side Effects: (Pasquali et al., 2003)
• Challenge Protocol: Finally, they immunized mice PO with RB51 and challenged them with S2308 PO or intraperitoneally (IP) 42 days after vaccination. Mice were PO vaccinated with RB51 preceded by gastric acidity neutralization or were IP inoculated with RB51 as mentioned above. Additional mice served as unvaccinated controls. PO and IP vaccinated mice and controls were challenged PO (2 x 10^10 CFU) or IP (2 x 10^4 CFU) with S2308 42 days after vaccination. PO challenge was preceded by gastric acid neutralization. Mice were bled and killed at 18 days after challenge. Spleens were weighed and homogenized to determine CFU as a means for assessing the protective response induced by vaccination. Sera were used to evaluate antibody titer against both S2308 and RB51 (Pasquali et al., 2003).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	2000000000 CFU in volume ml	oral gavage (actual dose = 2 x 10^10)	day	42 day
  2	S2308	20000 CFU in volume ml	Intraperitoneal injection (i.p.)	day	42 day

• Efficacy: PO RB51 was able to protect mice infected with S2308 PO but not to mice infected IP. Results indicate that oral inoculation of mice with RB51 is able to give protective immunity against oral infection with virulent strains and that this protection seems to rely on an immune response at the mucosal level (Pasquali et al., 2003).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	2.5 CFU	Mice were bled and killed at 18 days after challenge. Spleens were weighed and homogenized to determine CFU as a means for assessing the protective response induced by vaccination. PO RB51 was able to protect mice infected with S2308 PO (decreased CFU by 2.5 log) and to mice infected IP (1.5 log decrease). IP RB51 protection was not significant, though CFU was decreased by ~1 log following vaccination via PO and IP. Results indicate that oral inoculation of mice with RB51 is able to give protective immunity against oral infection with virulent strains and that this protection seems to rely on an immune response at the mucosal level (Pasquali et al., 2003).
  2	assay of CFU reduction in spleen	1.5 CFU	Mice were bled and killed at 18 days after challenge. Spleens were weighed and homogenized to determine CFU as a means for assessing the protective response induced by vaccination. PO RB51 was able to protect mice infected with S2308 PO (decreased CFU by 2.5 log) and to mice infected IP (1.5 log decrease). IP RB51 protection was not significant, though CFU was decreased by ~1 log following vaccination via PO and IP. Results indicate that oral inoculation of mice with RB51 is able to give protective immunity against oral infection with virulent strains and that this protection seems to rely on an immune response at the mucosal level (Pasquali et al., 2003).
  3	assay of CFU reduction in spleen	1 CFU	Mice were bled and killed at 18 days after challenge. Spleens were weighed and homogenized to determine CFU as a means for assessing the protective response induced by vaccination. PO RB51 was able to protect mice infected with S2308 PO (decreased CFU by 2.5 log) and to mice infected IP (1.5 log decrease). IP RB51 protection was not significant, though CFU was decreased by ~1 log following vaccination via PO and IP. Results indicate that oral inoculation of mice with RB51 is able to give protective immunity against oral infection with virulent strains and that this protection seems to rely on an immune response at the mucosal level (Pasquali et al., 2003).
  4	assay of CFU reduction in spleen	1 CFU	Mice were bled and killed at 18 days after challenge. Spleens were weighed and homogenized to determine CFU as a means for assessing the protective response induced by vaccination. PO RB51 was able to protect mice infected with S2308 PO (decreased CFU by 2.5 log) and to mice infected IP (1.5 log decrease). IP RB51 protection was not significant, though CFU was decreased by ~1 log following vaccination via PO and IP. Results indicate that oral inoculation of mice with RB51 is able to give protective immunity against oral infection with virulent strains and that this protection seems to rely on an immune response at the mucosal level (Pasquali et al., 2003).

• Description: (Pasquali et al., 2003)

Mouse Response

• Host Strain: C57BL/6 (IRF-1-/-)
• Vaccination Protocol: S2308 (the virulent wild-type Brucella abortus strain), S19 and RB51 (live attenuated vaccine strains), cyd and cbp (insertional mutants), and bap (deletion mutant) were used in this experiments. Interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. IRF1-/- mice were injected IP with diverse strains and CFU of B. abortus in 200 ul of PBS (Ko et al., 2002).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	IP S19 (5 x 10^1)	5	in volume		female	7.5 week	no	6- to 9-week-old interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. Mice were injected IP with Brucella abortus strain S19 in 200 ul of PBS. After 6 weeks of infection, surviving mice were challenged with 5 x 10^5 CFU of B. abortus S2308 in 200 ul of PBS (Ko et al., 2002).
  2	IP S19 (5 x 10^3)	5	in volume		female	7.5 week	no	6- to 9-week-old interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. Mice were injected IP with Brucella abortus strain S19 (5000 CFU) in 200 ul of PBS. After 6 weeks of infection, surviving mice were challenged with 5 x 10^5 CFU of B. abortus S2308 in 200 ul of PBS (Ko et al., 2002).
  3	IP RB51 (5 x 10^5)	5	in volume		female	7.5 week	no	6- to 9-week-old interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. Mice were injected IP with Brucella abortus strain RB51 (5 x 10^5) in 200 ul of PBS. After 6 weeks of infection, surviving mice were challenged with 5 x 10^5 CFU of B. abortus S2308 in 200 ul of PBS (Ko et al., 2002).
  4	IP RB51 (5 x 10^7 CFU)	5	in volume		female	7.5 week	no	6- to 9-week-old interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. Mice were injected IP with Brucella abortus strain RB51 (5 x 10^7 CFU) in 200 ul of PBS. After 6 weeks of infection, surviving mice were challenged with 5 x 10^5 CFU of B. abortus S2308 in 200 ul of PBS (Ko et al., 2002).
  5	IP cyd mutant (5 x 10^5 CFU)	5	in volume		female	7.5 week	no	6- to 9-week-old interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. Mice were injected IP with Brucella abortus cyd mutant (5 x 10^5 CFU) in 200 ul of PBS. After 6 weeks of infection, surviving mice were challenged with 5 x 10^5 CFU of B. abortus S2308 in 200 ul of PBS (Ko et al., 2002).
  6	IP cyd mutant (5 x 10^7 CFU)	5	in volume		female	7.5 week	no	6- to 9-week-old interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. Mice were injected IP with Brucella abortus cyd mutant (5 x 10^7 CFU) in 200 ul of PBS. After 6 weeks of infection, surviving mice were challenged with 5 x 10^5 CFU of B. abortus S2308 in 200 ul of PBS (Ko et al., 2002).
  7	IP saline	5	in volume		female	7.5 week	yes	6- to 9-week-old interferon regulatory factor 1-deficient (IRF1-/-) mice were originally produced by using C57BL/6 (H-2b) mice. Mice were injected IP with 200 ul of PBS. After 6 weeks of infection, surviving mice were challenged with 5 x 10^5 CFU of B. abortus S2308 in 200 ul of PBS (Ko et al., 2002).

• Persistence: To count residual CFU in the spleens or livers of mice, 5 mice from each group were examined at each sampling period. Brucella colonies were counted after a 3-day incubation. Serum glutamic oxalacetic transaminase (GOT) and glutamic pyruvic transaminase (GPT) were also quantitatively measured (Ko et al., 2002).
• Immune Response: (Ko et al., 2002)
• Challenge Protocol: After 6 weeks, surviving IRF1-/- mice were challenged with 5 x 10^5 CFU of S2308 in 200 ul of PBS (Ko et al., 2002).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	500000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	6 week

• Efficacy: Interferon regulatory factor 1-deficient (IRF1-/-) mice infected with virulent Brucella abortus (S)2308 at 5 x 10^5 CFU developed acute hepatitis similar to many natural hosts but, unlike natural hosts, IRF1-/- mice were unable to resolve infection and died. In contrast, IRF1-/- mice survived when infected at 5 x 10^5 CFU with several attenuated Brucella strains (S19, RB51, cbp, and cyd). Brucella-infected mice were also killed 12 days post-infection for histologic analysis (Ko et al., 2002).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	% survival of S19 at 50 CFU	80 CFU	Interferon regulatory factor 1-deficient (IRF1-/-) mice infected with virulent Brucella abortus (S)2308 at 5 x 10^5 CFU developed acute hepatitis similar to many natural hosts but, unlike natural hosts, IRF1-/- mice were unable to resolve infection and died. In contrast, IRF1-/- mice survived when infected at 5 x 10^5 CFU with attenuated Brucella strains S19 50 CFU (80% survival) and 5000 CFU (87.5%), RB51 at 500000 (62.5-87.5%) and 50000000 CFU (100%), and cyd mutant at 500000 (40-80%) and 50000000 CFU (90%). Brucella-infected mice were also killed 12 days post-infection for histologic analysis (Ko et al., 2002).
  2	% survival of S19 at 5000 CFU	87.5 CFU	Interferon regulatory factor 1-deficient (IRF1-/-) mice infected with virulent Brucella abortus (S)2308 at 5 x 10^5 CFU developed acute hepatitis similar to many natural hosts but, unlike natural hosts, IRF1-/- mice were unable to resolve infection and died. In contrast, IRF1-/- mice survived when infected at 5 x 10^5 CFU with attenuated Brucella strains S19 50 CFU (80% survival) and 5000 CFU (87.5%), RB51 at 500000 (62.5-87.5%) and 50000000 CFU (100%), and cyd mutant at 500000 (40-80%) and 50000000 CFU (90%). Brucella-infected mice were also killed 12 days post-infection for histologic analysis (Ko et al., 2002).
  3	% survival of RB51 at 500000 CFU	62.5-87.5 CFU	Interferon regulatory factor 1-deficient (IRF1-/-) mice infected with virulent Brucella abortus (S)2308 at 5 x 10^5 CFU developed acute hepatitis similar to many natural hosts but, unlike natural hosts, IRF1-/- mice were unable to resolve infection and died. In contrast, IRF1-/- mice survived when infected at 5 x 10^5 CFU with attenuated Brucella strains S19 50 CFU (80% survival) and 5000 CFU (87.5%), RB51 at 500000 (62.5-87.5%) and 50000000 CFU (100%), and cyd mutant at 500000 (40-80%) and 50000000 CFU (90%). Brucella-infected mice were also killed 12 days post-infection for histologic analysis (Ko et al., 2002).
  4	% survival of RB51 at 50000000 CFU	100 CFU	Interferon regulatory factor 1-deficient (IRF1-/-) mice infected with virulent Brucella abortus (S)2308 at 5 x 10^5 CFU developed acute hepatitis similar to many natural hosts but, unlike natural hosts, IRF1-/- mice were unable to resolve infection and died. In contrast, IRF1-/- mice survived when infected at 5 x 10^5 CFU with attenuated Brucella strains S19 50 CFU (80% survival) and 5000 CFU (87.5%), RB51 at 500000 (62.5-87.5%) and 50000000 CFU (100%), and cyd mutant at 500000 (40-80%) and 50000000 CFU (90%). Brucella-infected mice were also killed 12 days post-infection for histologic analysis (Ko et al., 2002).
  5	% survival of cyd at 50000000 CFU	40-80 CFU	Interferon regulatory factor 1-deficient (IRF1-/-) mice infected with virulent Brucella abortus (S)2308 at 5 x 10^5 CFU developed acute hepatitis similar to many natural hosts but, unlike natural hosts, IRF1-/- mice were unable to resolve infection and died. In contrast, IRF1-/- mice survived when infected at 5 x 10^5 CFU with attenuated Brucella strains S19 50 CFU (80% survival) and 5000 CFU (87.5%), RB51 at 500000 (62.5-87.5%) and 50000000 CFU (100%), and cyd mutant at 500000 (40-80%) and 50000000 CFU (90%). Brucella-infected mice were also killed 12 days post-infection for histologic analysis (Ko et al., 2002).
  6	% survival of cyd at 50000000 CFU	90 CFU	Interferon regulatory factor 1-deficient (IRF1-/-) mice infected with virulent Brucella abortus (S)2308 at 5 x 10^5 CFU developed acute hepatitis similar to many natural hosts but, unlike natural hosts, IRF1-/- mice were unable to resolve infection and died. In contrast, IRF1-/- mice survived when infected at 5 x 10^5 CFU with attenuated Brucella strains S19 50 CFU (80% survival) and 5000 CFU (87.5%), RB51 at 500000 (62.5-87.5%) and 50000000 CFU (100%), and cyd mutant at 500000 (40-80%) and 50000000 CFU (90%). Brucella-infected mice were also killed 12 days post-infection for histologic analysis (Ko et al., 2002).

• Description: (Ko et al., 2002)

Mouse Response

• Host Strain: BALB/c, DBA/2
• Vaccination Protocol: Young (2–3 month old) or old (16–18 month old) adult female mice (DBA/2 or BALB/c) were infected with either an attenuated Brucella abortus strain that over-expressed superoxide dismutase (RB51-SOD) or with a fully virulent wild-type strain (S2308). They were inoculated intra-peritoneally (IP) with 3.4 x 10^7 CFU or 6 x 10^8 CFU RB51-SOD, or with 2 x 10^4 or 4 x 10^9 CFU S2308. Uninfected control mice were injected with saline alone. Spleens harvested after sacrifice were cultured quantitatively for Brucella. Splenocytes (80–120 x 10^6) from mice were harvested and cultured in the presence of heat-killed B. abortus, purified SOD, or the mitogen concanavalin A (conA). Supernatants were assayed for the presence of cytokines by protein array and ELISA, semi-quantitatively measured by densitometry and the intensity of a given dot-blot compared to the mean of the positive control dots. Blood was obtained via retro-orbital bleeds. Total IgG, IgG1 and IgG2a titers vs. two Brucella proteins, bacterioferritin (BFR) and Cu++/Zn++ SOD, were assessed by ELISA (High et al., 2007).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	Young RB51-SOD (3.4 x 10^7 CFU)	5	in volume		female	2 month	no	Young adult female mice were infected with attenuated Brucella abortus that over-expresses superoxide dismutase (RB51-SOD). They were inoculated intra-peritoneally (IP) with 3.4 x 10^7 CFU. Spleens harvested after sacrifice were cultured quantitatively for brucellae (High et al., 2007).
  2	Old RB51-SOD (3.4 x 10^7 CFU)	5	in volume		female	18 month	no	Old (18 month old) adult female mice (DBA/2 or BALB/c) were infected with attenuated Brucella abortus that over-expressed superoxide dismutase (RB51-SOD). They were inoculated intra-peritoneally (IP) with 3.4 x 10^7 CFU (High et al., 2007).
  3	Young RB51-SOD (6 x 10^8 CFU)	5	in volume		female	2 month	no	Young (2 month old) adult female mice (DBA/2 or BALB/c) were infected with an attenuated Brucella abortus strain that over-expressed superoxide dismutase (RB51-SOD). They were inoculated intra-peritoneally (IP) with 6 x 10^8 CFU (High et al., 2007).
  4	Old RB51-SOD (6 x 10^8 CFU)	5	in volume		female	18 month	no	Old (18 month old) adult female mice (DBA/2 or BALB/c) were infected with an attenuated Brucella abortus strain that over-expressed superoxide dismutase (RB51-SOD). They were inoculated intra-peritoneally (IP) with 6 x 10^8 CFU RB51-SOD (High et al., 2007).
  5	Young S2308 (4 x 10^4 CFU)	5	in volume		female	2 month	no	Young (2 month old) adult female mice (DBA/2 or BALB/c) were infected with a fully virulent wild-type Brucella abortus strain (S2308). They were inoculated intra-peritoneally (IP) with 4 x 10^4 CFU S2308 (High et al., 2007).
  6	Old S2308 (4 x 10^4 CFU)	5	in volume		female	18 month	no	Old (18 month old) adult female mice (DBA/2 or BALB/c) were infected with a fully virulent wild-type Brucella abortus strain (S2308). They were inoculated intra-peritoneally (IP) with 4 x 10^4 CFU S2308 (High et al., 2007).
  7	Young S2308 (2 x 10^4 CFU)	9	in volume		female	2 month	no	Young (2 month old) adult female mice (DBA/2 or BALB/c) were infected with a fully virulent wild-type Brucella abortus strain (S2308). They were inoculated intra-peritoneally (IP) with 2 x 10^4 CFU S2308 (High et al., 2007).
  8	Old S2308 (2 x 10^4 CFU)	9	in volume		female	17 month	no	Old (16–18 month old) adult female mice (DBA/2 or BALB/c) were infected with a fully virulent wild-type Brucella abortus strain (S2308). They were inoculated intra-peritoneally (IP) with 2 x 10^4 CFU S2308 (High et al., 2007).
  9	Young S2308 (2 x 10^6 CFU)	9	in volume		female	2 month	no	Young (2 month old) adult female mice (DBA/2 or BALB/c) were infected with a fully virulent wild-type Brucella abortus strain (S2308). They were inoculated intra-peritoneally (IP) with 2 x 10^6 (High et al., 2007).
  10	Old S2308 (2 x 10^6 CFU)	9	in volume		female	17 month	no	Old (16–18 month old) adult female mice (DBA/2 or BALB/c) were infected with a fully virulent wild-type Brucella abortus strain (S2308). They were inoculated intra-peritoneally (IP) with 2 x 10^6 CFU S2308 (High et al., 2007).
  11	Young saline	5	in volume		female	2 month	yes	Young (2–3 month old) adult female control mice (DBA/2 or BALB/c) were inoculated intra-peritoneally (IP) with saline alone (High et al., 2007).
  12	Old saline	5	in volume		female	18 month	yes	Old (16–18 month old) adult female control mice (DBA/2 or BALB/c) were inoculated intra-peritoneally (IP) with saline alone (High et al., 2007).

• Persistence: All young and old mice survived infection with RB51-SOD (up to 6 x 1^08 CFU) or S2308 (up to 8 x 10^8 CFU). Old mice had a lower organism burden in the spleen than young mice 5 or more weeks after infection (High et al., 2007).
• Immune Response: Antibody and cytokine responses were Th1-focused in young mice, but Th-mixed in old mice, including evidence of the Th17 subtype immune response (High et al., 2007).
• Challenge Protocol: For protection studies, mice were either immunized with 4 x 10^8 CFU RB51-SOD or saline as a control and allowed to recover for 5 weeks. Mice were then infected with 2 x 10^4 CFU S2308 and sacrificed 2 weeks later for determination of CFU/spleen as above (High et al., 2007).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	20000 CFU in volume ml	Intraperitoneal injection (i.p.)	day	5 week

• Efficacy: Immunization with the RB51-SOD strain provided protection vs. strain 2308 challenge in young and aged BALB/c, but only young DBA/2 mice (High et al., 2007).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	1.5 CFU	Mean ± SEM cfu/spleen in old and young adult DBA/2 or BALB/c mice two weeks after infection with S2308 in mice that were either naıve or immunized with RB51-SOD five weeks prior to infection with strain 2308. Immunization with the RB51-SOD strain provided protection vs. strain 2308 challenge in young (~1.5 log decrease) and aged BALB/c (~2 log), but only young (~1 log) not in aged (<1 log) DBA/2 mice .Antibody and cytokine responses were Th1-focused in young mice, but Th-mixed in old mice, including evidence of the Th17 subtype immune response (High et al., 2007).
  2	assay of CFU reduction in spleen	2 CFU	Mean ± SEM cfu/spleen in old and young adult DBA/2 or BALB/c mice two weeks after infection with S2308 in mice that were either naıve or immunized with RB51-SOD five weeks prior to infection with strain 2308. Immunization with the RB51-SOD strain provided protection vs. strain 2308 challenge in aged BALB/c (~2 log), but only young (~1 log) not in aged (<1 log) DBA/2 mice .Antibody and cytokine responses were Th1-focused in young mice, but Th-mixed in old mice, including evidence of the Th17 subtype immune response (High et al., 2007).
  3	assay of CFU reduction in spleen	1 CFU	Mean ± SEM cfu/spleen in old and young adult DBA/2 or BALB/c mice two weeks after infection with S2308 in mice that were either naıve or immunized with RB51-SOD five weeks prior to infection with strain 2308. Immunization with the RB51-SOD strain provided protection vs. strain 2308 challenge only in young (~1 log) not in aged (<1 log) DBA/2 mice (High et al., 2007).
  4	assay of CFU reduction in spleen	0.3 CFU	Mean ± SEM cfu/spleen in old and young adult DBA/2 or BALB/c mice two weeks after infection with S2308 in mice that were either naıve or immunized with RB51-SOD five weeks prior to infection with strain 2308. Immunization with the RB51-SOD strain did not provide protection vs. strain 2308 challenge in aged (<1 log) DBA/2 mice .Antibody and cytokine responses were Th1-focused in young mice, but Th-mixed in old mice, including evidence of the Th17 subtype immune response (High et al., 2007).

Mouse Response

• Host Strain: BALB/c
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	RB51	5	in volume		female	10 week	no	Female BALB/c mice (10 weeks old) mice were divided into three groups; the first group was injected intraperitonealy (IP) with 5 x 10^8 CFU of the live rough Brucella abortus RB51 vaccine (Hamdy et al., 2002).
  2	Rev1	5	in volume		female	10 week	no	Female BALB/c mice (10 weeks old) mice were divided into three groups; the second group was inoculated intraperitonealy (IP) with 5 x 10^8 CFU with smooth B. melitensis Rev. 1 vaccine (Hamdy et al., 2002).
  3	PBS	5	in volume		female	10 week	yes	Female BALB/c mice (10 weeks old) mice were divided into three groups; the third group was inoculated intraperitonealy (IP) with 0.2 ml of sterile PBS and kept as a control (Hamdy et al., 2002).

• Challenge Protocol: Mice were challenged with a B. melitensis field strain. The humoral immune responses induced in mice after vaccination and challenge were detected by the standard tube agglutination test (SAT), mercaptoethanol test (MET), Rose Bengal plate test (RBPT), and buffered acidified plate antigen test (BAPAT). The detection of immune responses induced by the RB51 vaccine was measured by RB51 killed antigen. Mice were bled under anesthesia from the retroorbital sinus or from heart puncture. Sera were stored at -70C unless used on the same day. Five animals from each of the first and the second groups were sacrificed by CO2 asphyxiation at weekly intervals. Detection of Brucella vaccinal strains in internal organs (spleen, liver and lung) was done at weekly intervals. Two weeks after elimination of the vaccinal strains from the internal organs and disappearance of any serological reactions, the remaining animals and control were challenged with 5 x 10^5 cfu of B. melitensis i.p. in 0.2 ml PBS. Five of the challenged animals from each group were sacrificed every week until the end of the experiment. Sacrificed animals were subjected to serological and bacteriological investigations. Bacteriological examinations and viable counts of the Brucella organisms per spleen following challenge were carried out. Identification of the rough form of the RB51 vaccinal strain was achieved by auto-agglutination reaction with acriflavine solution (1/1000) and the ability to stain with crystal violet (Hamdy et al., 2002).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	B. melitensis field strain bv. 3	500000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	2 week

• Efficacy: Protection was assessed by a variety of serological tests and recovery of vaccinal and challenge strains by culture. Mice vaccinated with RB51 gave negative results in the conventional serological tests prior to challenge, standard tube agglutination test (SAT), Rose Bengal plate test (RBPT), buffered acidified plate antigen test (BAPAT), and mercaptoethanol test (MET). Sero-conversion took place to a whole-cell bacterial buffered RB51 antigen after vaccination and persisted for 7 weeks post-vaccination. Mice challenged with B. melitensis were assessed for bacterial load and immune response for 12 weeks after challenge. Protection units were showed that Rev. 1 vaccine was superior to RB51 vaccine in protection of mice against B. melitensis (Hamdy et al., 2002).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	1.14 CFU	Protection was assessed by a variety of serological tests and recovery of vaccinal and challenge strains by culture. Mice challenged with B. melitensis were assessed for bacterial load and immune response for 12 weeks after challenge. Log units of protection (decrease in splenic CFU) were measured at 2 (1.14 log decrease), 3 (1.5 log), 4 (~2 log), 5 (<1 log), 10 (<1 log), and 12 weeks (~1 log) (Hamdy et al., 2002).
  2	assay of CFU reduction in spleen	1.5 CFU	Protection was assessed by a variety of serological tests and recovery of vaccinal and challenge strains by culture. Mice challenged with B. melitensis were assessed for bacterial load and immune response for 12 weeks after challenge. Log units of protection (decrease in splenic CFU) were measured at 3 (1.5 log), 4 (~2 log), 5 (<1 log), 10 (<1 log), and 12 weeks (~1 log) (Hamdy et al., 2002).
  3	assay of CFU reduction in spleen	2 CFU	Protection was assessed by a variety of serological tests and recovery of vaccinal and challenge strains by culture. Mice challenged with B. melitensis were assessed for bacterial load and immune response for 12 weeks after challenge. Log units of protection (decrease in splenic CFU) were measured at 4 (~2 log), 5 (<1 log), 10 (<1 log), and 12 weeks (~1 log) (Hamdy et al., 2002).
  4	assay of CFU reduction in spleen	0.7 CFU	Protection was assessed by a variety of serological tests and recovery of vaccinal and challenge strains by culture. Mice challenged with B. melitensis were assessed for bacterial load and immune response for 12 weeks after challenge. Log units of protection (decrease in splenic CFU) were measured at 5 (<1 log), 10 (<1 log), and 12 weeks (~1 log) (Hamdy et al., 2002).
  5	assay of CFU reduction in spleen	0.5 CFU	Protection was assessed by a variety of serological tests and recovery of vaccinal and challenge strains by culture. Mice challenged with B. melitensis were assessed for bacterial load and immune response for 12 weeks after challenge. Log units of protection (decrease in splenic CFU) were measured at 10 (<1 log) and 12 weeks (~1 log) (Hamdy et al., 2002).
  6	assay of CFU reduction in spleen	1 CFU	Protection was assessed by a variety of serological tests and recovery of vaccinal and challenge strains by culture. Mice challenged with B. melitensis were assessed for bacterial load and immune response for 12 weeks after challenge. Log units of protection (decrease in splenic CFU) were measured at 12 weeks (~1 log) (Hamdy et al., 2002).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: This study determined if murine interleukin-12 (IL-12) would influence immunity in mice vaccinated with live or killed Brucella abortus strain RB51 (SRB51). Mice received live or irradiated SRB51 bacteria alone, or with IL-12 (0.5 or 1.0 jig, 2x or 3X), whereas other mice received saline or IL-12 alone. Specifically, female 10-week-old BALB/c AnNHsD mice (n = 12/group) were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 3 x 10^8 CFU of live SRB51 alone, or combined with 0.5 or 1.0 ug of murine recombinant IL-12, administered thrice (days 0, 5, and 21). Additional mice were vaccinated IP with 0.2 mL of saline containing 3 x 10^8 CFU of irradiated SRB51 alone, or combined with 0.5 or 1.0 ug of IL-12 administered twice (days 0 and 5) or thrice. Other mice were injected IP with 0.2 mL of saline alone or with saline containing 0.5 or 1.0 ug of IL-12 administered twice or thrice (Lee et al., 2001).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	live SRB51	12	in volume		female	10 week	no	Mice received live or irradiated Brucella abortus strain RB51 (SRB51) bacteria alone, or with murine interleukin-12 (IL-12) (0.5 or 1.0 ug, 2x or 3x), whereas other mice received saline or IL-12 alone. Specifically, female 10-week-old BALB/c AnNHsD mice (n = 12/group) were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 3 x 10^8 CFU of live SRB51 alone (Lee et al., 2001).
  2	live SRB51 + 0.5 ug IL-12	12	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice (n = 12/group) were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 3 x 10^8 CFU of live SRB51 combined with 0.5 ug of murine recombinant IL-12 administered thrice (Lee et al., 2001).
  3	live SRB51 + 1.0 ug IL-12	12	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice (n = 12/group) were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 3 x 10^8 CFU of live SRB51 combined with 1.0 ug of murine recombinant IL-12, administered thrice (days 0, 5, and 21). Additional mice were vaccinated IP with 0.2 mL of saline containing 3 x 10^8 CFU of irradiated SRB51 alone, or combined with 0.5 or 1.0 ug of IL-12 administered twice (days 0 and 5) or thrice. Other mice were injected IP with 0.2 mL of saline alone or with saline containing 0.5 or 1.0 ug of IL-12 administered twice or thrice (Lee et al., 2001).
  4	killed SRB51	8	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 3 x 10^8 CFU irradiated SRB51 alone (Lee et al., 2001).
  5	killed SRB51 + 0.5 ug IL-12	8	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 3 x 10^8 CFU of irradiated SRB51 combined with 0.5 ug of IL-12 administered twice (days 0 and 5) or thrice (Lee et al., 2001).
  6	killed SRB51 + 1.0 ug IL-12	12	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 3 x 10^8 CFU of irradiated SRB51 combined with 1.0 ug of IL-12 administered twice (days 0 and 5) or thrice (Lee et al., 2001).
  7	saline	12	in volume		female	10 week	yes	Female 10-week-old BALB/c AnNHsD mice were inoculated intraperitoneally (IP) with 0.2 mL of saline alone (Lee et al., 2001).
  8	saline + 0.5 ug IL-12	8	in volume		female	10 week	yes	Female 10-week-old BALB/c AnNHsD mice were inoculated intraperitoneally (IP) with 0.2 mL of saline containing 0.5 ug of IL-12 administered twice or thrice (Lee et al., 2001).
  9	saline + 1.0 ug IL-12	8	in volume		female	10 week	yes	Female 10-week-old BALB/c AnNHsD mice were inoculated intraperitoneally (IP) with 0.2 mL of saline containing 1.0 ug of IL-12 administered twice or thrice (Lee et al., 2001).

• Persistence: Post-vaccination antibody responses to live or killed SRB51 and clearance of live SRB51 from splenic tissue were not influenced by IL-12 treatments (Lee et al., 2001).
• Challenge Protocol: Mice were challenged at 12 weeks with 4 x 10^4 CFU of B. abortus strain 2308 (S2308) and were euthanized 2 weeks later. Remaining mice (n = 8/trt) were challenged IP with 4 X 104 cfu of S2308 at 12 wk after vaccination. The time of challenge was based on data from previous studies which demonstrated that a dosage of 5 X 108 cfu of SRB51 is cleared from BALB/c mice by 12 wk after IP vaccination (Lee et al., 2001).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	40000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	12 week

• Efficacy: The highest IL-12 treatment increased post-challenge antibody responses when co-administered with killed SRB51. Co-administration of 1.0 ug of IL-12 with live SRB51, but not killed SRB51, reduced S2308 colonization of splenic tissues. Following euthanasia with C02/02 at 2 wk after S2308 challenge, blood, spleens, and livers were obtained from all mice. Spleens were weighed, approximately onehalf was excised for bacteriologic examination and weighed, and remaining tissue was used to prepare spleen cell suspensions. Following weighing, the entire liver was designated for bacteriologic examination. Tissue for bacteriologic examination was stored at -69°C until processed (Lee et al., 2001).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	0.5-1.5 CFU	Co-administration of IL-12 with live SRB51, but not killed SRB51, reduced S2308 colonization of splenic tissues. Colonization of splenic and hepatic tissues as cfu (log1o) at 2 weeks after IP challenge with 4 X 10^4 cfu of S2308. Mice had been vaccinated 12 wk prior to challenge with live or killed SRB51, alone, or in combination with IL-12, or, with saline or IL-12 alone. CFU/g spleen was decreased less in mice vaccinated with live (~1 log less) or killed (0.5 log) SRB51 alone than in mice given IL-12 (~1.5 log) (Lee et al., 1999).
  2	assay of CFU reduction in liver	1.5 CFU	Co-administration of IL-12 with live SRB51, but not killed SRB51, reduced S2308 colonization of hepatic tissues. Colonization of tissues as cfu (log1o) at 2 weeks after IP challenge with 4 X 10^4 cfu of S2308. Mice had been vaccinated 12 wk prior to challenge with live or killed SRB51, alone, or in combination with IL-12, or, with saline or IL-12 alone. CFU/g liver was decreased significantly in mice vaccinated with live SRB51 +/- IL-12 (~1.5 log less) but not in mice given killed SRB51 (Lee et al., 1999).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: The present study was performed to delineate cytokine induction after intraperitoneal (IP) administration of Brucella abortus strain RB51 and subsequent infection with virulent strain B. abortus S2308. Twelve- to 14-week-old BALB/c female mice were allocated to experimental groups consisting of five animals each. Mice were vaccinated IP with 0.2 ml of saline containing 2 x 10^8 CFU of RB51. Unvaccinated control animals remained untreated throughout the experiment (Pasquali et al., 2001).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	RB51	5	in volume		female	13 week	no	Twelve- to 14-week-old BALB/c female mice were vaccinated IP with 0.2 ml of saline containing 2 x 10^8 CFU of RB51 (Pasquali et al., 2001).
  2	Saline control	5	in volume		female	13 week	yes	Twelve- to 14-week-old unvaccinated control BALB/c female mice were inoculated IP with 0.2 ml of saline and remained untreated throughout the experiment (Pasquali et al., 2001).

• Persistence: Vaccinated mice had higher spleen weights when compared to control animals after vaccination. Vaccination of mice with live RB51 resulted in a pattern of bacterial growth in which peak numbers were seen 18 days after vaccination, followed by a progressive decline. Bacteria were absent in the spleen at 42 days postvaccination. Counts on days 6 and 18 were significantly different (Pasquali et al., 2001).
• Immune Response: After vaccination, both Th1 and Th2 cytokine patterns were observed. Of those, the early production of gamma interferon seems to have the prominent role in inducing an immunologically based protection. Spleen weight in vaccinated and infected mice did not increase after challenge and were not significantly different from nonchallenged, vaccinated animals killed 42 days after vaccination. In contrast, spleen weights of unvaccinated and infected mice showed a significant enlargement as early as 6 days after infection. Vaccinated mice were almost refractory to a subsequent challenge infection with B. abortus 2308 cells, exhibiting significantly lower levels of infection compared to unvaccinated infected animals after infection. Vaccination alone induced a number of significant effects upon cytokine expression. Spleen cells from unvaccinated mice stimulated with heat-inactivated RB51 cells did not produce measurable cytokines throughout the course of the experiment. Similarly, spleen cells from vaccinated mice killed 6 and 18 days after vaccination did not produce measurable bio-active IL-12 (p70) when stimulated in vitro, but a low level of production was detectable in spleen cells from mice killed 42 days after vaccination (Pasquali et al., 2001).
• Challenge Protocol: At 42 days after vaccination, unvaccinated controls and IP vaccinated mice were challenged IP with 0.2 ml of saline containing 2 x 10^4 CFU of B. abortus 2308. At 6, 18, and 42 days after vaccination and 3, 6, and 10 days after challenge, mice were euthanatized and spleens were aseptically removed. Approximately one-third of the spleen was weighed and homogenized in PBS, and an aliquot of the resulting cell suspension was plated to determine the number of CFU. The remaining 2/3 of the spleens were weighed, minced, and used to prepare spleen cell suspensions. Cytokine expression was assayed in culture supernatants of splenocytes stimulated with 10^8 heat-inactivated B. abortus RB51 or 2308 bacteria per well. Cytokines were detected by ELISA according to the manufacturer’s instructions (Pasquali et al., 2001).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	20000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	42 day

• Efficacy: RB51 confers a solid immunity that protects mice against a challenge infection with virulent B. abortus 2308. After vaccination, both Th1 and Th2 cytokine patterns were observed. Protection may be more dependent upon the timing of the cytokine response rather than on the absolute level of cytokine expression. Challenge infection of vaccinated and nonvaccinated mice induced even more marked increases in cytokine expression patterns. IL-12 p40 was detectable in spleen cells from both vaccinated and unvaccinated mice after challenge infection, and there were no significant differences between vaccinated and unvaccinated mice. Similar results were seen throughout the course of the experiment for IL-12 p70 production, which was low at all times in all groups of mice. In contrast, IFN- production was detectable as early as 3 days after challenge infection in spleen cells from both vaccinated and unvaccinated mice, although levels were significantly higher in vaccinated mice. Levels of IFN in spleen cells from vaccinated, challenged mice showed no differences throughout the experiment, in contrast to spleen cells from unvaccinated, challenged mice which showed increased IFN production that reached levels seen in spleen cells from vaccinated, challenged mice 6 days after challenge. After challenge infection, low levels of IL-4 were detectable, reaching a peak in spleen cells 6 days after challenge. However, levels were not different between vaccinated and unvaccinated mice. IL-10 showed a pattern similar to that of IFN-. IL-10 was detectable in both vaccinated and unvaccinated mice after challenge infection. However, vaccinated and challenged animals did not show any differences at different times after challenge. Conversely, IL-10 production in unvaccinated, challenged mice was first detectable 6 days after challenge infection and reached a peak 10 days after challenge infection. Results of this study indicated that mice vaccinated with RB51 cells were protected as early as 3 days after a challenge infection with virulent B. abortus 2308 cells. In vaccinated mice, challenge infection resulted in high levels of IL-10 production at all times tested. In contrast, in unvaccinated mice, IL-10 production reached levels comparable to that in the vaccinated mice beginning 6 days after infection. Previous studies indicate that both IL-10 and IFN- are produced following a B. abortus infection and that IL-10 induction does not down-regulate IFN- production. This implies that in brucellosis, the effect of IL-10 on the immune response is to limit the consequences of an exaggerated proinflammatory response more than to counterbalance the production of Th1 cytokines. These findings are in agreement with others which measured IL-10 production following Brucella infection (Pasquali et al., 2001).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	1.1 CFU	At 3, 6, and 10 days after challenge, mice were euthanatized and spleens were aseptically removed and used to determine the number of CFU and cytokine expressionvia ELISA. RB51 confers a solid immunity that protects mice against a challenge infection with virulent B. abortus 2308. Both Th1 and Th2 cytokine patterns were observed. Challenge infection of vaccinated and nonvaccinated mice induced even more marked increases in cytokine expression patterns. Persistence of B. abortus S2308 in spleens of vaccinated and unvaccinated mice was also analyzed as splenic CFU decrease at 3 days (1.1 log less than unvaccinated controls), 6 days (2.2 log less), and 10 days (2.4 log) post-challenge (Pasquali et al., 2001).
  2	assay of CFU reduction in spleen	2.2 CFU	At 3, 6, and 10 days after challenge, mice were euthanatized and spleens were aseptically removed and used to determine the number of CFU and cytokine expressionvia ELISA. RB51 confers a solid immunity that protects mice against a challenge infection with virulent B. abortus 2308. Both Th1 and Th2 cytokine patterns were observed. Challenge infection of vaccinated and nonvaccinated mice induced even more marked increases in cytokine expression patterns. Persistence of B. abortus S2308 in spleens of vaccinated and unvaccinated mice was also analyzed as splenic CFU decrease at 3 days (1.1 log less than unvaccinated controls), 6 days (2.2 log less), and 10 days (2.4 log) post-challenge (Pasquali et al., 2001).
  3	assay of CFU reduction in spleen	2.4 CFU	At 3, 6, and 10 days after challenge, mice were euthanatized and spleens were aseptically removed and used to determine the number of CFU and cytokine expressionvia ELISA. RB51 confers a solid immunity that protects mice against a challenge infection with virulent B. abortus 2308. Both Th1 and Th2 cytokine patterns were observed. Challenge infection of vaccinated and nonvaccinated mice induced even more marked increases in cytokine expression patterns. Persistence of B. abortus S2308 in spleens of vaccinated and unvaccinated mice was also analyzed as splenic CFU decrease at 3 days (1.1 log less than unvaccinated controls), 6 days (2.2 log less), and 10 days (2.4 log) post-challenge (Pasquali et al., 2001).

Mouse Response

• Host Strain: Deer mouse (Peromyscus maniculatus)
• Vaccination Protocol: This study was designed to determine effects of strain RB51 on deer mice (Peromyscus maniculatus), a nontarget species that could have access to treated baits in a field situation. 90 mice were orally dosed (PO) or intraperitoneally injected (IP) with 1 x 10^8 colony forming units (CFU) strain RB51, and 77 controls were similarly dosed with sterile saline. At weekly intervals for 2 months, 4-6 mice from each group were euthanized, gross necropsies performed, spleens and uteruses cultured, and tissues examined histologically (Cook et al., 2001).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	IP saline	37	in volume		female	3-5 month	yes	One hundred eighty captive raised 3–5 mo-old deer mice were randomly divided into four groups of 45 each containing approximately equal numbers of males and nonpregnant females. Mice were given a 2 wk acclimation period prior to beginning the experiment. To allow comparison of oral inoculation (PO) with intraperitoneal inoculation (IP), the standard test method in laboratory mice, both IP and PO experimental groups were established. Because some mortality occurred during the acclimation period, some groups had fewer than 45 mice remaining. One group (n = 37) of mice was injected IP with 0.2 ml of 0.85% sterile saline pH 7.0. Every week for 8 wk beginning 1 wk post inoculation (WPI) 4-6 mice were euthanized via cervical dislocation and necropsied (Cook et al., 2001).
  2	PO saline	40	in volume		female	3-5 month	yes	One hundred eighty captive raised 3–5 mo-old deer mice were randomly divided into four groups of 45 each containing approximately equal numbers of males and nonpregnant females. Mice were given a 2 wk acclimation period prior to beginning the experiment. To allow comparison of oral inoculation (PO) with intraperitoneal inoculation (IP), the standard test method in laboratory mice, both IP and PO experimental groups were established. Because some mortality occurred during the acclimation period, some groups had fewer than 45 mice remaining. One group of mice (n = 40) was orally dosed with 0.2 ml of 0.85% saline via a tuberculin syringe (without a needle). Every week for 8 wk beginning 1 wk post inoculation (WPI) 4-6 mice were euthanized via cervical dislocation and necropsied (Cook et al., 2001).
  3	IP RB51	45	in volume		female	3-5 month	no	One hundred eighty captive raised 3–5 mo-old deer mice were randomly divided into four groups of 45 each containing approximately equal numbers of males and nonpregnant females. Mice were given a 2 wk acclimation period prior to beginning the experiment. To allow comparison of oral inoculation (PO) with intraperitoneal inoculation (IP), the standard test method in laboratory mice, both IP and PO experimental groups were established. Because some mortality occurred during the acclimation period, some groups had fewer than 45 mice remaining. One group of mice (n = 45) was injected IP with 0.2 ml of 85% sterile saline pH 7.0 containing 1 x 10^8 colony forming units (CFU) of Brucella abortus strain RB51. Every week for 8 wk beginning 1 wk post inoculation (WPI) 4-6 mice were euthanized via cervical dislocation and necropsied (Cook et al., 2001).
  4	PO RB51	45	in volume		female	3-5 month	no	One hundred eighty captive raised 3–5 mo-old deer mice were randomly divided into four groups of 45 each containing approximately equal numbers of males and nonpregnant females. Mice were given a 2 wk acclimation period prior to beginning the experiment. To allow comparison of oral inoculation (PO) with intraperitoneal inoculation (IP), the standard test method in laboratory mice, both IP and PO experimental groups were established. Because some mortality occurred during the acclimation period, some groups had fewer than 45 mice remaining. The last group of mice (n = 45) was orally dosed with 0.2 ml of 0.85% sterile saline pH 7.0 containing 1 x 10^8 CFU of RB51. Every week for 8 wk beginning 1 wk post inoculation (WPI) 4-6 mice were euthanized via cervical dislocation and necropsied (Cook et al., 2001).

• Persistence: All PO inoculated mice cleared the infection by 6 weeks post-inoculation (wpi). While most of the injected mice cleared the infection by 7 wpi, a few required 9 w. With one possible exception (see below), no lesions attributable to brucellosis were noted on gross necropsy. Mice orally inoculated with RB51 developed low level splenic infections with strain RB51, but all were negative by 6 wk PI. RB51 was isolated from the uterus of one orally inoculated mouse necropsied 2 wk PI; no other orally inoculated mouse had a uterine infection. IP inoculated mice had a higher rate of splenic and uterine infections and took longer to clear the infections than orally inoculated mice with some remaining positive at 8 wk PI (Cook et al., 2001).
• Immune Response: Nine of the 20 (45%) orally inoculated (PO) RB51 mice necropsied in the first 4 wk post-inoculation (WPI) had mild multifocal pleocelluar inflammatory infiltrates in the liver; 3/25 (12%) PO RB51 mice necropsied after 4 WPI had similar lesions. All 10 of the RB51 IP mice necropsied in the first 2 WPI had multifocal pleocellular inflammatory infiltrates in the liver; 2/10 (20%) RB51 IP mice necropsied 3-4 WPI had similar lesions, and only 1 necropsied after 4 WPI from this group had these lesions. Generally, lesions in the IP group were more severe (more cellular infiltrates) than in the PO RB51 group. Lesions were milder in mice at longer times PI. One PO RB51 male mouse necropsied 5 WPI had a mild lymphocytic infiltrate in the interstitium of the seminal vesicle, but no RB51 was recovered from the spleen. Culture results were usually correlated with histologic lesions. Mice with the highest number of colonies of RB51 isolated were those with the most severe lesions (Cook et al., 2001).
• Side Effects: There were minimal adverse effects attributable to strain RB51. RB51 would not negatively impact P. maniculatus populations if it were used in a field situation. Incidental findings found in some mice in all groups included: mild myocarditis (19% of controls; 30% of RB51 inoculates), mild metritis (10% of controls; 5% of RB51 inoculates), mild multifocal pyogranulomatous pneumonia (8% of controls; 5% of RB51 inoculates), and nematodes in the small intestines and/or cecum (54% of controls; 33% of RB51 inoculates). In a field situation, deer mice would only be exposed to the vaccine PO and not IP. All the orally exposed animals remained clinically healthy with no evidence of illness. Orally exposed mice had fewer CFU cultured from their spleens and uteruses, cleared the vaccine more quickly, and had milder lesions than mice inoculated IP. Strain RB51, with the possible exception of one IP inoculated animal, did not cause significant morbidity or mortality (Cook et al., 2001).

Mouse Response

• Host Strain: Deer mice (Peromyscus maniculatus)
• Vaccination Protocol: Deer mice (Peromyscus maniculatus, n = 14) were orally inoculated (PO) with Brucella abortus strain SRB51 or physiologic saline. Oral and rectal swabs and blood samples were collected for bacteriologic evaluation. Rodents were necropsied at 8-10 wk and 12-21 wk post inoculation (WPI). Spleen, liver and reproductive tissues were collected for bacteriologic and histopathologic evaluation (Januszewski et al., 2001).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	RB51	14	in volume		female	day	no	21 mature deer mice of either sex selected from a breeding colony located at the National Wildlife Research Center were maintained individually in the Animal Research Building. Deer mice were randomly divided into SRB51-inoculated (n = 14) and control (n = 7) groups. SRB51-inoculated deer mice orally (PO) received SRB51 in a 1 ml volume. Control animals were given the same oral volume of physiologic saline PO. All animals were observed daily. Oral and rectal swabs were collected from all deer mice prior to inoculation and weekly throughout the study. At necropsy, tissues were evaluated for gross lesions and bacteriologic and histologic evaluation (Januszewski et al., 2001).
  2	Saline control	7	in volume		female	day	yes	21 mature deer mice of either sex selected from a breeding colony located at the National Wildlife Research Center were maintained individually in the Animal Research Building. Deer mice were randomly divided into SRB51-inoculated (n = 14) and control (n = 7) groups. SRB51-inoculated deer mice orally (PO) received SRB51 in a 1 ml volume. Control animals were given the same oral volume of physiologic saline PO. All animals were observed daily. Oral and rectal swabs were collected from all deer mice prior to inoculation and weekly throughout the study. At necropsy, tissues were evaluated for gross lesions and bacteriologic and histologic evaluation (Januszewski et al., 2001).

• Persistence: No differences in clinical signs, appetite, weight loss or gain, or activity were observed between saline- and SRB51-inoculated animals. Oral and rectal swabs were negative throughout the study. In tissues obtained from SRB51-inoculated animals, the organism was isolated from 1/6 (17%) deer mice necropsied at 8 WPI. SRB51 was not recovered from deer mice necropsied 12 WPI. SRB51 was not recovered from saline-inoculated deer mice at any time. Results indicate oral exposure to SRB51 does not produce morbibity or mortality in deer mice (Januszewski et al., 2001).
• Side Effects: One SRB51-inoculated mouse died immediately after inoculation, and one control mouse died at 4 days PI. Deaths were attributed to handling and probable aspiration of the inoculum. Results indicate oral exposure to SRB51 does not produce morbibity or mortality in deer mice (Januszewski et al., 2001).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Six-week-old BALB/c female mice were inoculated intraperitoneally (IP) with 4 x 10^8 CFU of Brucella abortus strains RB51 or S2308 or the same volume of saline (negative control). The mice were euthanatized at 6 weeks postimmunization (wpi) by CO2 inhalation. These mice served as splenocyte sources for CTL assays. Splenocytes from strain RB51-infected or saline-inoculated mice were resuspended in 2 ml of c-RPMI and passed through nylon wool columns to enrich for cytotoxic T lymphocytes (CTLs). After 5-day incubation, cells were collected, and live effector cells were obtained by removing dead cells by Histopaque centrifugation. CTLs were also collected and used for flow cytometric analysis, magnetic cell sorting, and colorimetric CTL assay (He et al., 2001).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	RB51	3	in volume		female	6 week	no	Six-week-old BALB/c female mice were inoculated intraperitoneally (IP) with 4 x 10^8 CFU of Brucella abortus strain RB51. The mice were euthanatized at 6 weeks postimmunization (wpi) by CO2 inhalation. These mice served as splenocyte sources for CTL assays. Splenocytes from strain RB51-infected or saline-inoculated mice were resuspended in 2 ml of c-RPMI and passed through nylon wool columns to enrich for cytotoxic T lymphocytes (CTLs). After 5-day incubation, cells were collected, and live effector cells were obtained by removing dead cells by Histopaque centrifugation. CTLs were also collected and used for flow cytometric analysis, magnetic cell sorting, and colorimetric CTL assay (He et al., 2001).
  2	S2308	3	in volume		female	6 week	no	Six-week-old BALB/c female mice were inoculated IP with 4 x 10^8 CFU of S2308. The mice were euthanatized at 6 wpi by CO2 inhalation. These mice served as splenocyte sources for CTL assays. Splenocytes from strain RB51-infected or saline-inoculated mice were resuspended in 2 ml of c-RPMI and passed through nylon wool columns to enrich for CTLs. After 5-day incubation, cells were collected, and live effector cells were obtained by removing dead cells by Histopaque centrifugation. CTLs were also collected and used for flow cytometric analysis, magnetic cell sorting, and colorimetric CTL assay (He et al., 2001).
  3	Saline control	3	in volume		female	6 week	yes	Six-week-old BALB/c female mice were inoculated IP with 4 x 10^8 CFU of RB51 or S2308 or the same volume of saline (negative control). The mice were euthanatized at 6 wpi by CO2 inhalation. These mice served as splenocyte sources for CTL assays. Splenocytes from strain RB51-infected or saline-inoculated mice were resuspended in 2 ml of c-RPMI and passed through nylon wool columns to enrich for CTLs. After 5-day incubation, cells were collected, and live effector cells were obtained by removing dead cells by Histopaque centrifugation. CTLs were also collected and used for flow cytometric analysis, magnetic cell sorting, and colorimetric CTL assay (He et al., 2001).

• Immune Response: RB51 vaccination of mice induces specific CTLs and suggest that CD3+ CD4+ and CD3+ CD8+ T cells play a synergistic role in the anti-Brucella activity. Specifically, Brucella abortus strain RB51 vaccination of mice induced specific cytotoxic T lymphocytes (CTLs) against both RB51- and virulent strain 2308-infected J774.A1 macrophages but not against Listeria monocytogenes-infected J774.A1 cells. The antigen-specific cytotoxic activity was exerted by CTLs but not by NK cells. CD3+ CD4+ T cells secreted the highest level of gamma interferon (IFN) and were able to exert a low but significant level of specific lysis of Brucella-infected macrophages. They also exerted a low level of nonspecific lysis of noninfected macrophages. In contrast, CD3+ CD8+ T cells secreted low levels of IFN-g but demonstrated high levels of specific lysis of Brucella-infected macrophages with no nonspecific lysis (He et al., 2001).
• Efficacy: RB51 vaccination of mice resulted in the development of a strong cytotoxic T-cell (CTL) response. The specific anti-Brucella cytolytic activity was mainly exerted by CD3+ CD8+ T cells. CD3+ CD4+ T cells also developed after immunization, secreted high levels of IFN, and exhibited certain levels of specific and nonspecific lytic activity against Brucella-infected target cells. NK cells appeared not to contribute significantly to the observed Brucella-specific cytotoxic activity (He et al., 2001).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: This study was designed to determine if a single 0.5 ug administration of recombinant murine interleukin-12 (IL-12) would influence immune responses of mice vaccinated with live or killed Brucella abortus strain RB51 (SRB51). A total of 180 (n = 30/treatment) female 10-week-old BALB/c AnNHsD mice were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 5 x 10^8 cfu of live or gamma-irradiated SRB51 bacteria alone, or in combination with 0.5 ug of IL-12. Control mice received saline +/- 0.5 ug of IL-12 (Lee et al., 1999).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	Saline control	30	in volume		female	10 week	yes	A total of 30 female 10-week-old BALB/c AnNHsD mice were vaccinated IP with 0.2 mL of saline (Lee et al., 1999).
  2	Saline + IL-12	30	in volume		female	10 week	yes	A total of 30 female 10-week-old BALB/c AnNHsD mice were vaccinated intraperitoneally (IP) with 0.2 mL of saline + 0.5 ug of IL-12 (Lee et al., 1999).
  3	Live SRB51	30	in volume		female	10 week	no	A total of 30 female 10-week-old BALB/c AnNHsD mice were vaccinated intraperitoneally (IP) with 0.2 mL of saline containing 5 x 10^8 cfu of live SRB51 bacteria alone (Lee et al., 1999).
  4	Irradiated SRB51	30	in volume		female	10 week	no	A total of 30 female 10-week-old BALB/c AnNHsD mice were vaccinated IP with 0.2 mL of saline containing 5 x 10^8 cfu of gamma-irradiated SRB51 bacteria alone (Lee et al., 1999).
  5	Live SRB51 + IL-12	30	in volume		female	10 week	no	A total of 30 female 10-week-old BALB/c AnNHsD mice were vaccinated IP with 0.2 mL of saline containing 5 x 10^8 cfu of live SRB51 in combination with 0.5 ug of IL-12 (Lee et al., 1999).
  6	Irradiated SRB51 + IL-12	30	in volume		female	10 week	no	A total of 30 female 10-week-old BALB/c AnNHsD mice were vaccinated IP with 0.2 mL of saline containing 5 x 10^8 cfu of gamma-irradiated SRB51 bacteria in combination with 0.5 ug of IL-12 (Lee et al., 1999).

• Persistence: Mice vaccinated with live SRB51 or live SRB51+IL-12 had greater serum antibody titers against SRB51 at 2, 4, 8, and 12 wpv when compared to all other treatments. When combined with live or killed SRB51, IL-12 as an adjuvant did not influence serologic responses at 2, 4, 8, or 12 wpv. In the absence of IL-12 as an adjuvant, spleen cells obtained at 12 wk after IP vaccination with live SRB51 had greater stimulation indexes against irradiated S2308 when compared to responses of spleen cells from other treatments. Administration of IL-12 as an adjuvant with live or killed SRB51 did not enhance lymphocyte proliferative responses to S2308 (Lee et al., 1999).
• Challenge Protocol: Mice (n = 10/treatment) were challenged IP with 2 X 10^4 cfu of S2308 at 12 weeks post-vaccination (wpv). Blood samples and spleens were obtained from mice in all treatments after CO2/O2 euthanasia at 2, 4, 8, and 12 wpv (n = 5/treatment/time). Following C02/02 euthanasia at 2 weeks after S2308 challenge (wpc), blood and spleens were obtained from mice in all treatments (n = 10/treatment). Cells from 5 mice from each treatment were evaluated separately at 2, 4, 8, and 12 wpv. Following S2308 challenge, spleen cell suspensions from 10 mice from each treatment were combined into 5 separate suspensions (2 mice/suspension, 5 suspensions/treatment) for evaluation of lymphocyte proliferative responses. Cell proliferation results were expressed as stimulation indices (counts/min in presence of antigen divided by counts/min in medium only) (Lee et al., 1999).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	20000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	12 week

• Efficacy: The clearance of SRB51 from spleens of mice vaccinated with live SRB51 alone, or in combination with IL-12, did not differ at 2, 4, 8, or 12 wk after vaccination. At 12 wk after vaccination, spleens of mice vaccinated with either live SRB51 or live SRB51+IL-12 were culture negative for SRB51. IL-12 did not influence the clearance of strain RB51 from splenic tissue. Spleen weights of mice vaccinated with live SRB51 or live SRB51+IL-12 were greater at 2, 4, 8, or 12 wpv when compared to saline controls, IL-12 controls, or mice receiving either vaccination treatment using killed SRB51. Addition of exogenous IL-12 to culture supernatants of spleen cells obtained at 4 and 8 wk, but not at 2 or 12 wpv, enhanced lymphocyte proliferative responses of all vaccine treatments. Maximal enhancement of lymphocyte response was associated with
  the addition of IL-12. Mice vaccinated with live SRB51 (5 X 108 cfu) had lower spleen weights, total spleen cfu, and spleen cfu/g following challenge at 12 wk after vaccination when compared to mice receiving saline control, IL-12 control, or killed SRB51 treatments. Administration of IL-12 as an adjuvant with live or killed SRB51 did not enhance resistance against experimental challenge with S2308 (Lee et al., 1999).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	2 CFU	Colonization of splenic tissues 2 wk following IP challenge with 2 x 10^4 cfu of S2308 was analyzed via resulting CFU/g spleen +/- IL-12. Mice vaccinated with live SRB51 had lower total spleen cfu and spleen cfu/g (>2 log decreased CFU) following challenge at 12 wk after vaccination when compared to mice receiving saline control, IL-12 control (~0.5 log decreased), or killed (~1 log) SRB51 treatments. Administration of IL-12 as an adjuvant with live or killed SRB51 did not enhance resistance against experimental challenge with S2308 (Lee et al., 1999).
  2	assay of CFU reduction in spleen	0.5 CFU	Colonization of splenic tissues 2 wk following IP challenge with 2 x 10^4 cfu of S2308 was analyzed via resulting CFU/g spleen +/- IL-12. Mice vaccinated with live SRB51 had lower total spleen cfu and spleen cfu/g (>2 log decreased CFU) following challenge at 12 wk after vaccination when compared to mice receiving saline control, IL-12 control (~0.5 log decreased), or killed (~1 log) SRB51 treatments. Administration of IL-12 as an adjuvant with live or killed SRB51 did not enhance resistance against experimental challenge with S2308 (Lee et al., 1999).
  3	assay of CFU reduction in spleen	1 CFU	Colonization of splenic tissues 2 wk following IP challenge with 2 x 10^4 cfu of S2308 was analyzed via resulting CFU/g spleen +/- IL-12. Mice vaccinated with live SRB51 had lower total spleen cfu and spleen cfu/g (>2 log decreased CFU) following challenge at 12 wk after vaccination when compared to mice receiving saline control, IL-12 control (~0.5 log decreased), or killed (~1 log) SRB51 treatments. Administration of IL-12 as an adjuvant with live or killed SRB51 did not enhance resistance against experimental challenge with S2308 (Lee et al., 1999).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Immune responses and resistance to infection with Brucella abortus 2308 (S2308) were measured in mice following oral (PO) or intraperitoneal (IP) vaccination with strain RB51 (SRB51). Female 10-week-old BALB/c AnNHsD mice were used in the following experiments. Lyophilized SRB51 reconstituted in a 0.15 M NaCl saline solution was used to vaccinate PO by placing 20 ml of saline containing 5 x 10^8 or 5 x 10^6 CFU onto the pharyngeal mucosa. Additional groups of mice were vaccinated IP with 0.2 ml of saline containing 5 x 10^8 or 5 x 10^6 CFU of SRB51. Nonvaccinated control mice were injected IP with 0.2 ml of saline alone (Stevens et al., 1996).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	PO SRB51 5 x 10^8 CFU	12	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were vaccinated PO by placing 20 ml of saline containing 5 x 10^8 CFU onto the pharyngeal mucosa (Stevens et al., 1996).
  2	PO SRB51 5 x 10^6 CFU	12	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were given lyophilized SRB51 reconstituted in a 0.15 M NaCl saline solution PO by placing 20 ml of saline containing 5 x 10^6 CFU onto the pharyngeal mucosa (Stevens et al., 1996).
  3	IP SRB51 5 x 10^8 CFU	12	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were given lyophilized SRB51 reconstituted in a 0.15 M NaCl saline solution was used to vaccinate mice IP with 0.2 ml of saline containing 5 x 10^8 CFU of SRB51 (Stevens et al., 1996).
  4	IP SRB51 5 x 10^6 CFU	12	in volume		female	10 week	no	Female 10-week-old BALB/c AnNHsD mice were given lyophilized SRB51 reconstituted in a 0.15 M NaCl saline solution and were vaccinated IP with 0.2 ml of saline containing 5 x 10^6 CFU of SRB51 (Stevens et al., 1996).
  5	IP Saline control	12	in volume		female	10 week	yes	Female 10-week-old BALB/c AnNHsD mice were injected IP with 0.2 ml of saline alone (Stevens et al., 1996).

• Persistence: Bacteria persisted in the parotid lymph node for 4 weeks following PO vaccination of mice with 5 x 10^8 or 5 X 10^6 CFU of SRB51. Bacteria did not appear in the spleen during 12 weeks after PO vaccination, whereas they did appear in the spleen for 8 weeks following IP vaccination of mice with SRB51. Increased resistance to S2308 infection occurred at 12-20 weeks in mice vaccinated IP with SRB51 but occurred at 12 weeks only in mice vaccinated PO with 5 x 10^8 CFU SRB51 (Stevens et al., 1996).
• Immune Response: Oral SRB51 vaccination induced lower levels of antibodies to the surface antigens of intact SRB51 bacteria than did IP vaccination (Stevens et al., 1996).
• Challenge Protocol: Nonvaccinated control mice and vaccinated mice at 12, 16, or 20 weeks after vaccination were challenged with S2308 by an IP injection of 2 x 10^4 CFU in 0.2 ml of 0.15 M NaCl saline solution (Stevens et al., 1996).
• Challenge Detail:

  No.	Pathogen Name	Dose	Route	Age	Interval
  1	S2308	20000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	12 week
  2	S2308	20000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	16 week
  3	S2308	20000 CFU in volume 0.2 ml	Intraperitoneal injection (i.p.)	day	20 week

• Efficacy: Neither route of vaccination induced anamnestic antibody responses to the surface antigens of intact S2308 bacteria after challenge infection of the vaccinated mice with S2308. Mice vaccinated PO with SRB51 and challenged with S2308 at 12-20 weeks had lower and less persistent spleen cell proliferation and production of gamma interferon (IFN) in response to S2308 and certain immunodominant S2308 proteins (<18-32 kDa) than did mice vaccinated IP with SRB51. However, mice had similar spleen cell tumor necrosis factor alpha (TNF) production. These results indicate that PO vaccination of mice with SRB51 was effective in inducing protective immunity to S2308 infection, although the immunity was lower and less persistent than that induced by IP vaccination. The lower protective immunity induced by oral vaccination may have resulted from lower and less persistent cell-mediated immunity and IFN production in response to S2308 and S2308 proteins (Stevens et al., 1996).
• Efficacy Detail:

  No.	Efficacy method	Result	Description	Group Efficacy Detail
  1	assay of CFU reduction in spleen	2-3 CFU	Increased resistance to S2308 infection, as measured by splenic CFU reduction, occurred at 12-20 weeks in mice vaccinated IP with SRB51 but occurred at 12 weeks only in mice vaccinated PO. Resistance to infection in SRB51-vaccinated mice following challenge infection with S2308. Mice were challenged with S2308 at 12, 16, or 20 weeks after IP or PO vaccination with SRB51. CFU reduction was greatest following IP SRB51 vaccination with 5 x 10^8 CFU (2-3 log decrease at 12-20 weeks post-challenge) and with 5 x 10^6 CFU (1.5-2 log decrease). PO SRB51 vaccination led to less of a reduction, whether used at 5 x 10^8 CFU (0.3-1 log decrease) or at 5 x 10^6 CFU (0-0.3 log decrease) (Stevens et al., 1996).
  2	assay of CFU reduction in spleen	1.5-2 CFU	Increased resistance to S2308 infection, as measured by splenic CFU reduction, occurred at 12-20 weeks in mice vaccinated IP with SRB51 but occurred at 12 weeks only in mice vaccinated PO. Resistance to infection in SRB51-vaccinated mice following challenge infection with S2308. Mice were challenged with S2308 at 12, 16, or 20 weeks after IP or PO vaccination with SRB51. CFU reduction was greatest following 5 x 10^6 CFU (1.5-2 log decrease). PO SRB51 vaccination led to less of a reduction, whether used at 5 x 10^8 CFU (0.3-1 log decrease) or at 5 x 10^6 CFU (0-0.3 log decrease) (Stevens et al., 1996).
  3	assay of CFU reduction in spleen	0.3-1 CFU	Increased resistance to S2308 infection, as measured by splenic CFU reduction, occurred at 12-20 weeks in mice vaccinated IP with SRB51 but occurred at 12 weeks only in mice vaccinated PO. Resistance to infection in SRB51-vaccinated mice following challenge infection with S2308. Mice were challenged with S2308 at 12, 16, or 20 weeks after IP or PO vaccination with SRB51. PO SRB51 vaccination led to less of a reduction, whether used at 5 x 10^8 CFU (0.3-1 log decrease) or at 5 x 10^6 CFU (0-0.3 log decrease) (Stevens et al., 1996).
  4	assay of CFU reduction in spleen	0-0.3 CFU	Increased resistance to S2308 infection, as measured by splenic CFU reduction, occurred at 12-20 weeks in mice vaccinated IP with SRB51 but occurred at 12 weeks only in mice vaccinated PO. Resistance to infection in SRB51-vaccinated mice following challenge infection with S2308. Mice were challenged with S2308 at 12, 16, or 20 weeks after IP or PO vaccination with SRB51. PO SRB51 vaccination led to less of a reduction, just a 0-0.3 log decrease at 5 x 10^6 CFU (Stevens et al., 1996).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: BALB/c mice were inoculated intraperitoneally (IP) with suspensions of Brucella abortus strains 2308 or RB51 or an htrA mutant. Spleens were examined on post-inoculation day (PID) 2, 4, 7, 10, 15, 21, 30, and 60. 132 male BALB/c mice were infected with either one of the 3 B. abortus strains or with saline as a control (Palmer et al., 1996).
• Vaccination Groups:

  No.	Group Name	Number of Animals	Dose	Route	Gender	Age	Control Group?	Comment	Vaccination Detail
  1	S2308 group	42	in volume		male	day	yes	BALB/c mice were inoculated IP with 1 x 10^4 CFU S2308 in 0.2 ml saline (Palmer et al., 1996).
  2	RB51 group	42	in volume		male	day	no	BALB/c mice were inoculated IP with RB51 (5 x 10^7 CFU) in 0.2 ml saline (Palmer et al., 1996).
  3	htrA group	42	in volume		male	day	no	BALB/c mice were inoculated IP with an htrA mutant strain (5 x 10^4 CFU) in 0.2 ml saline (Palmer et al., 1996).
  4	Saline control	6	in volume		male	day	yes	Control BALB/c mice were injected IP with 0.2 ml saline alone (Palmer et al., 1996).

• Persistence: Brucellae were cultured in high numbers from the spleens of mice infected with strains 2308 or htrA through PID 60; however, mice infected with RB51 cleared the infection between PID 30 and 60. Histopathologic changes in spleens from 2308-infected mice were characterized by marked accumulations of macrophages, which expanded marginal zones beginning as early as PID 7 and persisting through PID 60. Morphometric analysis showed a decrease in splenic white pulp in 2308-infected mice at PID 10, which correlated with the peak of bacterial infection. Although this decrease was significant when compared with values at previous and following time periods, it was not significantly different from white pulp values noted at PID 2 or 4 or the values for control spleens (Palmer et al., 1996).
• Immune Response: Spleens from RB51-infected mice showed only mild to moderate accumulations of macrophages in marginal zone areas during the peak of RB51 infection (PID 7-10). Morphometric analysis of RB51-infected spleens showed a decrease in white pulp area, which coincided with peak bacterial numbers. However, this decrease was not significant. Spleens from mice infected with htrA showed moderate to marked accumulations of macrophages in marginal zone areas, which persisted through PID 60. Multifocal necrosis in lymphoid follicles as early as PID 4 was seen in both htrA and 2308 infection (Palmer et al., 1996).
• Efficacy: Morphometric analysis of htrA-infected spleens revealed no significant decrease in white pulp and no obvious correlation with bacterial numbers in the spleen. These results suggest that virulent B. abortus does not induce lymphoid depletion significantly below those values seen in noninfected mice; thus, the possible role of lymphoid depletion in the pathogenesis of brucellosis remains questionable (Palmer et al., 1996).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Specific-pathogen-free 4-week-old BALB/c female mice were obtained. 25 mice were randomly divided in to five groups of 5 mice each and received intramuscular injections in the tibialis anterior muscles with 100 μg of pTargeTomp31 in 50 μl sterile saline by using a 1-ml insulin syringe with a 28-gauge needle. Similarly, another set of 6 weeks old 25 female mice (divided in five groups of 5 mice each) were sham immunized with saline only, the control group. From both the DNA immunized and sham immunized mice, one group of 5 mice each was exclusively used in order to obtain sera to test antibody and spleen cells for cytokine production in response to omp31 or B. melitensis extract. Three vaccinations at 3-week intervals were performed (Gupta et al., 2007).
• Immune Response: Mice injected with pTargeTomp31 have good IgG2a and IgG1 titers to anti-omp31 antibodies. Antibodies against omp31 could already be detected 1 week after the first pTargeTomp31 DNA injection. Immunization with pTargeT did not induce any production of anti-omp31 antibodies. Humoral response measured 18 weeks postvaccination indicates that pTargeTomp31 DNA vaccine leads to the generation of long-lived IgG1 and IgG2a responses. pTargeTomp31 DNA vaccination resulted in specific T-cell proliferation in response to omp31 or to Brucella extracts. This specific induced proliferative response was also found at 8 weeks postvaccination, although to a lesser extent. In contrast, immunization with pTargeT appeared to have no effect on the level of T-cell proliferative response. The ConA mitogen was able to induce T-cell proliferation in all cases (Gupta et al., 2007).
• Challenge Protocol: Mice immunized three times with pTargeTomp31 or pTargeT were infected 9 weeks later the last DNA immunization with B. melietensis 16M. Seven, 14, 21 and 28 days after challenge, mice were killed and the number of bacteria in the spleens was quantitated (Gupta et al., 2007).
• Efficacy: No significant difference in the number of the bacteria isolated from the spleens of the saline vaccinated and pTargeT-vaccinated animals was observed. The mice, which were immunized by pTargeTomp31, showed a significant level of protection at 28 days after challenge. Mice immunized with DNA vaccine made anti-Brucella serum antibody. This vaccine provided the moderate degree of protection to the mice (Gupta et al., 2007).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Specific pathogen-free female BALB/c mice were i.n. immunized with bp26 (50 μg/dose), Tf (100 μg/dose), or both + CT adjuvant on days 0, 7, and 14. Five μg of CT were given on day 0, and with subsequent boosts, 2 μg/dose were given. Mice were sampled for serum and fecal titers at 3–5 weeks post-immunization, before challenge (Yang et al., 2007).
• Immune Response: Mice immunized with Tf alone showed reduced serum and mucosal Ab titers. Between 3 and 5 weeks post-primary immunization, mice given bp26 + Tf showed between 14- and 32-fold greater serum IgG anti-Tf Ab titers when compared to mice given only Tf. Fecal IgA titers were augmented between 24- and 128-fold in mice immunized with bp26 + Tf when compared to mice immunized with Tf alone. These results clearly show that co-immunization with bp26 enhances anti-Tf immunity. To determine whether immune responses evoked by bp26 and Tf are biased towards Th1-type, Th2-type, or a mixture of both, serum samples from bp26 + Tf-immunized BALB/c mice from day 35 were evaluated for IgG subclass responses. IgG1 was the predominant IgG subclass Ab induced by the nasal immunization regimen. IgG2a and IgG2b anti-Tf and anti-bp26 Abs were also observed, but these were significantly less than the induced IgG1 Ab titers (Yang et al., 2007).
• Challenge Protocol: Immunized mice were challenged i.p. with 5 × 10^4 CFU B. melitensis strain 16 M on day 28 post-primary immunization [13]. A positive vaccination control was given i.p. 1 × 10^8 CFU of B. abortus RB51 vaccine 8 weeks prior to challenge. Four weeks post-challenge, splenic CFU and splenic weights were determined (Yang et al., 2007).
• Efficacy: Mice immunized with bp26 and Tf exhibited significantly reduced B. melitensis colonization when compared to PBS-dosed control mice, the control. There was no significant difference between mice immunized with these proteins when compared to RB51-vaccinated mice. No significant differences in splenic weights were observed among any of the immunization groups. These findings show that nasal immunization with bp26 and Tf is able to reduce B. melitensis colonization, and the observed splenic inflammation may be contributed by CT immunization (Yang et al., 2007).

Mouse Response

• Vaccination Protocol: BALB/c mice was immunized with an Omp31 DNA vaccine (pCIOmp31) followed by boosting with recombinant Omp31 (rOmp31) in incomplete Freund's adjuvant (Cassataro et al., 2007).
• Immune Response: Immunoglobulin G1 (IgG1) and IgG2a titers were higher in sera from pCIOmp31/rOmp31-immunized mice than in sera from mice immunized with pCIOmp31 or rOmp31 alone. Splenocytes from pCIOmp31/rOmp31-immunized mice produced significantly higher levels of gamma interferon than did those from mice given rOmp31 alone. In contrast, interleukin 2 (IL-2) production levels were comparable between the two groups of immunized mice. Cells from all immunized mice produced undetectable levels of IL-4. Notably, rOmp31 stimulated IL-10 production in the pCIOmp31/rOmp31-immunized group but not in the pCIOmp31- or rOmp31-immunized group. Although the prime-boost regimen induced specific cytotoxic responses, these responses could not reach the levels achieved by the pCIOmp31 immunization (Cassataro et al., 2007).
• Challenge Protocol: Immunized mice were challenged, by intravenous inoculation, with 1x10^5 B. melitensis H38S organisms or 1x10^5 B. ovis organisms. Mice were sacrificed 30 days after the bacterial challenge, and their spleens were removed, homogenized, plated, and incubated. The number of CFU per spleen or liver was counted, and the results were given as the mean log number of CFU (Cassataro et al., 2007).
• Efficacy: pCIOmp31 priming followed by rOmp31 boosting led to moderately improved protection against a challenge with B. ovis or B. melitensis (Cassataro et al., 2007).
• Host Ifng (Interferon gamma) response
  • Description: Cytokine secretion in culture supernatants of spleen cells from immunized mice was evaluated by ELISA 30 days after the last immunization. IFN-gamma levels were significantly higher in mice immunized with pCIOmp31 priming and rOmp31 boosting than mice immunized with PBS-, pCI-, or rOmp31 and boosted with rOmp31 (Cassataro et al., 2007).
  • Detailed Gene Information: Click Here.
• Host Il10 (interleukin 10) response
  • Description: Cytokine secretion in culture supernatants of spleen cells from immunized mice was evaluated by ELISA 30 days after the last immunization. IL-10 levels were significantly higher in mice immunized with pCIOmp31 priming and rOmp31 boosting than mice immunized with PBS-, pCI-, or rOmp31 and boosted with rOmp31 (Cassataro et al., 2007).
  • Detailed Gene Information: Click Here.
• Host Il2 response
  • Description: Cytokine secretion in culture supernatants of spleen cells from immunized mice was evaluated by ELISA 30 days after the last immunization. IL-2 levels were significantly higher in mice immunized with pCIOmp31 priming and rOmp31 boosting than mice immunized with PBS-, pCI-, or rOmp31 and boosted with rOmp31 (Cassataro et al., 2007).
  • Detailed Gene Information: Click Here.

Mouse Response

• Vaccine Immune Response Type: VO_0000286
• Immune Response: Brucella specific IFNγ was still evident at 12 weeks post-vaccination, albeit at low concentration, indicating generation of a lasting Th1 immune response (Commander et al., 2007).
• Efficacy: P-ialB vaccine was very promising in terms of control of Brucella challenge, as they were unable to recover viable Brucella from the spleens of 60% (three out of five) p-ialB treated mice of a study group following challenge with ∼1 × 104 CFU B. melitensis 16M per mouse. The remaining two mice showed significantly reduced Brucella loads compared to the unvaccinated (PBS and vector control) mice. If the data is considered in terms of the % of animals without detectable Brucella in their spleens (less than 10 CFU per spleen) at 15 days post-challenge, the effect of the p-ialB vaccination is judged to be equivalent to that of the Rev.1 live attenuated vaccine, with each vaccine able to ‘protect’ 60% of the test population. Moreover, a comparison of the total quantitative data available from each sample shows the Brucella load of the p-ialB and Rev.1 vaccinated animals to be significantly lower (p < 0.05, one-way ANOVA, Dunnett's post-test) than that observed for the unprotected controls (PBS or pcDNA3.1 vector control vaccinated mice). This vaccine was shown to have a protective index of greater than 2.5 (Commander et al., 2007).

Mouse Response

• Vaccine Immune Response Type: VO_0000286
• Immune Response: Brucella specific IFNγ was still evident at 12 weeks post-vaccination, albeit at low concentration, indicating generation of a lasting Th1 immune response (Commander et al., 2007).
• Efficacy: P-omp25 vaccine was very promising in terms of control of Brucella challenge, as researchers were unable to recover viable Brucella from the spleens of 60% (three out of five) p-omp25 treated mice of a study group following challenge with ∼1 × 104 CFU B. melitensis 16M per mouse. The remaining two mice showed significantly reduced Brucella loads compared to the unvaccinated (PBS and vector control) mice. If the data is considered in terms of the % of animals without detectable Brucella in their spleens (less than 10 CFU per spleen) at 15 days post-challenge, the effect of the p-omp25 vaccination is judged to be equivalent to that of the Rev.1 live attenuated vaccine, with each vaccine able to ‘protect’ 60% of the test population. Moreover, a comparison of the total quantitative data available from each sample shows the Brucella load of the p-omp25 and Rev.1 vaccinated animals to be significantly lower (p < 0.05, one-way ANOVA, Dunnett's post-test) than that observed for the unprotected controls (PBS or pcDNA3.1 vector control vaccinated mice). This vaccine was shown to have a protective index of greater than 2.5 (Commander et al., 2007).

Mouse Response

• Vaccine Immune Response Type: VO_0000286
• Immune Response: The Omp31 DNA vaccine induces cytotoxic responses that have the potential to contribute to protection against Brucella infection. The protective response could be related to the induction of CD8(+) T cells that eliminate Brucella-infected cells via the perforin pathway (Cassataro et al., 2005).
• Efficacy: Mice given pCIOmp31 exhibited a significant degree of protection against B. melitensis and B. ovis (P < 0.001) compared with controls receiving PBS. This was determined by comparing the levels of infection in the spleen (CFU) (Cassataro et al., 2005).

Mouse Response

• Vaccine Immune Response Type: VO_0000286
• Immune Response: The vaccine induced a strong humoral response against the inserted peptide. It also induced peptide- and BLS-specific cytotoxic T responses. The insertion of this peptide on BLS induced stronger T helper 1 responses specific for the carrier (BLS) (Cassataro et al., 2007).
• Efficacy: BLSOmp31 (pCIBLSOmp31) provided the best protection level against Brucella ovis, which was significantly higher than the given by the co-delivery of both plasmids coding for the whole proteins (pcDNABLS+pCIOmp31) and even higher than the control vaccine Rev.1. Moreover, pCIBLSOmp31 induced higher protection against Brucella melitensis than pcDNABLS+pCIOmp31 (Cassataro et al., 2007).

Mouse Response

• Vaccination Protocol: Groups of female BALB/c mice (Harlan Sprague-Dawley) were immunized by either i.n. or s.c. with purified B. melitensis LPS or LPS-GBOMP noncovalent complex vaccine. Control mice were immunized subcutaneously with sterile saline. Briefly, 25 µl of vaccine containing either 10 µg LPS or 10 µg LPS and 7.5 µg GBOMP contained in sterile saline was administered dropwise into the nostrils of anesthetized mice. Two doses of vaccine were given four weeks apart. For subcutaneous immunization, mice were given 10 µg vaccine in 200 µl sterile saline under the right hind thigh. A second dose of vaccine was given four weeks after the first dose. Blood was collected from five euthanized mice from each group four weeks after the first dose and four weeks after the second dose of vaccine. Sera were collected and stored at –20°C until analyzed for antibody. An enzyme-linked immunosorbent assay (ELISA) was used (Bhattacharjee et al., 2006).
• Challenge Protocol: Groups of immunized mice (15 to 20 mice in each group) were challenged intranasally 4 weeks after the second dose of vaccine with 1x10^4 CFU of B. melitensis 16M suspended in 30 µl phosphate-buffered saline (PBS) (0.01 M sodium phosphate, 0.14 M sodium chloride; pH 7.5) as described previously (21). Blood, spleens, lungs, and livers were aseptically collected from anesthetized mice 8 weeks postchallenge. The numbers of Brucella CFU in organs were determined by dilution and culture on brucella agar as described previously (17). Serum was separated and stored at –20°C until it was used (Bhattacharjee et al., 2006).
• Efficacy: Mice immunized subcutaneously with LPS vaccine showed significant protection against infection of the spleen (P < 0.001), liver (P < 0.001), and lungs (P < 0.05).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Each mouse was given an intramuscular injection of 0.3 mg of xylazine hydrochloride and 1.0 mg of ketamine hydrochloride in 50 μl of sterile saline prior to immunization. The mice were then immunized by administration of 25 μl of vaccine containing 10 μg of LPS slowly into the nostrils with a micropipette, with a second dose of vaccine was given 4 weeks after the initial dose (Bhattacharjee et al., 2002).
• Immune Response: Anti-B. melitensis LPS IgG titers were significantly increased two weeks after i.n. immunization with B. melitensis LPS-GBOMP vaccine. The pattern of IgG1 response closely resembled that of total IgG, but IgG2a and IgG2b responses were blunted compared to the IgG1 response,and the IgG3 response was also blunted compared to that of IgG1(Bhattacharjee et al., 2002).
• Challenge Protocol: Groups of immunized and control mice were challenged intranasally at various times with 10^4 CFU of B. melitensis 16 M suspended in 30 μl of phosphate-buffered saline. In one experiment, mice were challenged with 10^5 CFU of bacteria (Bhattacharjee et al., 2002).
• Efficacy: I.n. immunization with B. melitensis LPS-GBOMP subunit vaccine significantly protects mice against intranasal challenge with virulent B. melitensis. Vaccination reduces spleen and liver bacterial dissemination but has no effect on the course of lung infection (Bhattacharjee et al., 2002).

Mouse Response

• Host Strain: Balb/c mice
• Vaccination Protocol: Female BALB/c mice at 4 weeks of age were separated into nine groups of 12 mice. Groups 1, 2, and 3 received PBS, CpG ODN, and non-CpG ODN, respectively, and served as negative controls. Groups 4 and 5 were injected with the purified P39 and bacterioferrin (BFR) alone, respectively. Groups 6 and 7 were injected with the recombinant protein with CpG ODN adjuvant. Finally, groups 8 and 9 received the recombinant antigens with the non-CpG ODN. Vaccines were prepared in PBS and contained combinations of the following: 20 μg of recombinant protein and/or 20 μg of oligonucleotides when needed. Vaccines were given intramuscularly (i.m.) into the left tibial anterior muscles in a total volume of 50 μl three times at 3-week intervals (Al-Mariri et al., 2001).
• Persistence: Not reported.
• Side Effects: None reported.
• Challenge Protocol: Three weeks after the last injection, the remaining mice of each group were challenged by the intraperitoneal route (i.p.) with 5 × 10^4 CFU of B. abortus strain 544 in 100 μl of PBS. An additional group of eight mice vaccinated i.p. with B19 (1x10^5 CFU) was challenged 4 weeks later in the same way and served as a vaccinated control. Spleen colonization with the challenge strain was determined at 4 and 8 weeks postinfection (Al-Mariri et al., 2001).

Mouse Response

• Host Strain: VTRM1
• Vaccination Protocol: Five groups of mice, (eight to nine weeks old), were vaccinated with the following live organism vaccines. These included: VTRM1, VTRS1, and Rev 1 (5 x 10^4 CFU); strain 19 (S19) (5 x 10^3 CFU); and RB51 (3 x 10^8 CFU). Each vaccine was delivered intravenously except RB51 which was administered intraperitoneally. All vaccines except RB51 were obtained directly from frozen stock cultures. Large doses of RB51 were required, therefore stock cultures were inoculated onto plates. After three days of culture and growth after 3 days was diluted to the appropriate concentration (Winter et al., 1996).
• Challenge Protocol: Eight weeks after the initial vaccination, mice were injected IV with 5x10^4 CFU of Brucella. The time interval between IV injection and euthanasia was two weeks for all Brucella strains with the exception of B abortus 8-954 and 2-1230; for these strains, a one-week time interval was chosen. Mice were euthanized by CO2 asphyxiation. Individual spleens were homogenized, the homogenate diluted serially, and plated on Schaedler blood agar. B abortus, B melitensis, or B suis colonies were counted after three days of incubation; B. ovis colonies were counted after four to five days of incubation at 37 C under 10% CO2 (Winter et al., 1996).
• Efficacy: Strains VTRM1 and VTRS1 were effective in inducing protection against virulent strains of heterologous, and homologous, Brucella spp. Vaccination with either strain conferred substantial protection against exposure to virulent laboratory strains of B melitensis, B abortus, and B suis of biovars 1 and 4. VTRM1 provided protection against B. ovis (Winter et al., 1996).

Mouse Response

• Vaccination Protocol: Several groups of 10 (or eight mice in the assay after storage or passage) were vaccinated subcutaneously with Rev. 1 strains. Control unvaccinated mice received BSS alone (Bosseray, 1991).
• Challenge Protocol: Vaccinated and control mice were challenged intraperitoneally 30 or 45 days after vaccination with The virulent B. abortus 544 CO2-dependent reference challenge strain (Bosseray, 1991).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: The mice were immunized by intraperitoneal administration of vaccine. Each vaccine contained approximately 10^5 WR201 cells Nonimmunized, control mice received 0.9% NaCl intraperitoneally (Hoover et al., 1999).
• Immune Response: After mice were innoculated, they were found to have made serum antibody to non-O-polysaccharide and lipopolysaccharideantigens. The splenocytes from the immunized animals were found to have released interleukin-2, gamma interferon, and IL-10 when cultured with Brucella antigens (Hoover et al., 1999).
• Challenge Protocol: Nine weeks post immunization, animals were innoculated intranasally with 10^4 CFU of B. melitensis 16M in 30 μl of 0.9% NaCl. The vaccine was administered dropwise into the external nares with a micropipette (Hoover et al., 1999).
• Efficacy: Immunization of the mice led to protection from disseminated infection. Immunization had only a slight effect on the clearance of the challenge inoculum from the lungs (Hoover et al., 1999).
• Description: This study suggests that WR201 may be a good vaccine candidate for the prevention of human brucellosis (Hoover et al., 1999).
• Host Ifng (Interferon gamma) response
  • Description: Spleen cells obtained 9 weeks after inoculation of mice with WR201 produced more IFN-gamma than non-immunized, non-infected control mice. These results were significant (Hoover et al., 1999).
  • Detailed Gene Information: Click Here.
• Host IgG response
  • Description: Sera obtained from immunized animals from 1 to 8 weeks after intraperitoneal administration of WR201 showed a rise in anti-protein IgG by week 4 (Hoover et al., 1999).
  • Detailed Gene Information: Click Here.
• Host Il10 (interleukin 10) response
  • Description: Spleen cells obtained 9 weeks after inoculation of mice with WR201 produced more IL-10 than non-immunized, non-infected control mice. These results were significant (Hoover et al., 1999).
  • Detailed Gene Information: Click Here.
• Host Il2 response
  • Description: Spleen cells obtained 9 weeks after inoculation of mice with WR201 produced more IL-2 than non-immunized, non-infected control mice. These results were significant (Hoover et al., 1999).
  • Detailed Gene Information: Click Here.

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Mice were first orally administered 0.2 ml of sterile 2.5% sodium bicarbonate, then they were administered 0.2 ml of the bacterial suspension which had been standardized to 5 × 10^11 cells/ml. In designated experiments, bacteria were further diluted to provide an inoculum of 1010 or 109 CFU, then administered. In another experiment, strain WR201 was killed by treatment overnight at room temperature with 0.8% (vol/vol) formaldehyde prior to administration to mice (Izadjoo et al., 2004).
• Persistence: No bacteria were recovered from the spleens of 54 mice eight weeks post-vaccination, while no bacteria were recovered from the iguinal lymph nodes of 15 mice at this time either. Strain WR201 was progressively lost from the feces following oral administration (Izadjoo et al., 2004).
• Immune Response: When grown in cultures with Brucella antigens, splenocytes from immunized animals released interleukin-2 and gamma interferon. Immunized mice made serum antibody to lipopolysaccharide and non-O-polysaccharide antigens (Izadjoo et al., 2004).
• Challenge Protocol: For virulent strain 16M i.n. challenge, 30 μl of bacterial suspension adjusted to contain 104 CFU of bacteria. This was administered with a micropipette into the external nares of mice (Izadjoo et al., 2004).
• Efficacy: The mice that were immunized had protection from infection and better clearance of the challenge inoculum from the lungs. The best protection was found with the administration of live bacteria with the inclusion of a booster dose. The results suggest that strain WR201 may be a candidate for a vaccine to prevent human brucellosis (Izadjoo et al., 2004).

Mouse Response

• Vaccination Protocol: Mice, (eight to nine weeks old), in experimental groups of five, were vaccinated with live vaccines: VTRM1, VTRS1, and Rev 1 with 5 x 10^4 CFU (IV); strain 19 (S19) 5 x 10^3 CFU given IV; and RB51, 3 x 10^8 CFU given i.p. All vaccines except RB51 were obtained from frozen stock cultures. The large dose of RB51 administered required that stock cultures be cultured on plates, and after three days diluted to the appropriate concentration (Winter et al., 1996).
• Challenge Protocol: Eight weeks after the initial vaccination, mice were challenged IV with 5x10^4 CFU of Brucella. From challenge exposure to euthanasia was 2 weeks for all Brucella strains except B abortus 8-954 and 2-1230. For these strains a 1-week interval was used. Mice were euthanized with CO2. Individual spleens were homogenized, diluted serially, and plated on Schaedler blood agar. Colonies were counted after incubation for 3 days (B. abortus, B. melitensis, and B. suis) or 4 to 5 days (B. ovis) at 37 C under 10% CO2 (Winter et al., 1996).
• Efficacy: VTRM1 and VTRS1 were effective in inducing protection against virulent strains of heterologous, as well as the homologous, Brucella spp. Vaccination with either strain conferred protection against challenge exposure with virulent laboratory strains of B. abortus, B. melitensis, and B. suis of biovars 1 and 4. VTRM1 also provided protection against B. ovis (Winter et al., 1996).

Mouse Response

• Host Strain: BALB/c, C57BL/6 and C57BL/6 IFNγ−/− mice
• Vaccination Protocol: Eight to 12-week-old mice were infected intra-peritoneally with 5 × 10^4 bacterial colony forming units of B. abortus 2308, bacAmut-KL7 or hfq3 (Parent et al., 2007).
• Persistence: IFNγ-activated macrophages equivalently controlled strains 2308 and bacAmut-KL7. The bacAmut-KL7 organism and its LPS induced greater amounts of pro-inflammatory cytokines than 2308 (Parent et al., 2007).
• Immune Response: The C57BL/6 mice mounted a strong TH1 immune response to infection with B. abortus which was characterized by continuous IFNγ production. At 4 weeks post-infection, a time corresponding to the plateau phase of infection, there was no significant difference in the number of 2308 and bacAmut-KL7 CFU recovered from C57BL/6 mice. BacAmut-KL7 was significantly attenuated in BALB/c mice during this time. During the clearance phase of the infection bacAmut-KL7 did show significant attenuation in C57BL/6 mice relative to 2308 although it was much less than that observed in BALB/c mice (Parent et al., 2007).
• Side Effects: The bactAmut-KL7 mutant was more pathogenic in C57BL/6 interferon-γ-deficient mice than 2308 causing abscesses and wasting even though the splenic loads of bacAmut-KL7 were significantly lower (Parent et al., 2007).
• Challenge Protocol: No challenge was conducted, but it is known that the mutant created, bacAmut-KL7, has protected against challenge in previous experiments (Parent et al., 2007).

Mouse Response

• Persistence: Brucella DeltaexsA mutant showed decreased survival in mice compared to the survival of parental strain S2308 (Rosinha et al., 2002a).
• Efficacy: Challenge experiments revealed that the exsA mutant strain induced superior protective immunity in BALB/c mice compared to the protective immunity induced by strain S19 or RB51 (Rosinha et al., 2002a).

Mouse Response

• Persistence: A pgk mutant is attenuated in mice (Trant et al., 2010).
• Efficacy: A pgk mutant induces significant protection from challenge with wild type B. abortus (Trant et al., 2010).
• Host Ifng (Interferon gamma) response
  • Description: In IRF-1 KO mice, significantly increased levels of IFN-gamma were produced after vaccination with a pgk mutant as compared to medium. Animals immunized with strain RB51 showed reduced production of IFN-γ compared to mice vaccinated with the Δpgk mutant and S19, but it was not a statistically significant difference (Trant et al., 2010).
  • Detailed Gene Information: Click Here.

Mouse Response

• Persistence: A pgm mutant is attenuated in mice (Ugalde et al., 2003).
• Efficacy: A pgm mutant induces significant protection in mice from challenge with wild type B. abortus (Ugalde et al., 2003).
• Host Ifng (Interferon gamma) response
  • Description: Spleen cells from Δpgm-vaccinated mice were induced to secrete high levels of IFN-γ 8 weeks after immunization after stimulation with heat-inactivated B. abortus S2308 whole cells. The levels were compared to a positive control, the nonspecific mitogen ConA, and were significant (Ugalde et al., 2003).
  • Detailed Gene Information: Click Here.

Mouse Response

• Persistence: An encapsulated vjbR mutant is attenuated in mice (Arenas-Gamboa et al., 2009).
• Efficacy: A single dose of an encapsulated vjbR mutant induced protection in mice from challenge with wild type Brucella (Arenas-Gamboa et al., 2009).
• Host Ighg1 response
  • Description: Mouse immunization with encapsulated S19 ΔvjbR::Kan induced higher IgG1 and IgG2a levels compared to the nonencapsulated S19 ΔvjbR::Kan mutant 3 weeks post vaccination and significantly higher levels than naive mice (Arenas-Gamboa et al., 2009).
  • Detailed Gene Information: Click Here.
• Host Ighv1-9 response
  • Description: Mouse immunization with encapsulated S19 ΔvjbR::Kan induced higher IgG1 and IgG2a levels compared to the nonencapsulated S19 ΔvjbR::Kan mutant 3 weeks post vaccination and significantly higher levels than naive mice (Arenas-Gamboa et al., 2009).
  • Detailed Gene Information: Click Here.

Mouse Response

• Vaccination Protocol: Mice were anaesthetized and immunized by the intramuscular route with 100 ug of pcDNABLS, pCIOmp31, pCIBLSOmp31, pcDNABLS + pCIOmp31 (100
• Challenge Protocol: Thirty days after the last DNA injection, mice were challenged with 1 ×10^4 CFU of B. melitensis H38S or B. ovis (i.v.). Thirty days post challenge the animals were sacrificed and their spleens aseptically removed.
• Efficacy: Vaccinationof BALB/c mice with pCIBLSOmp31 provided optimal protection level against B. ovis (3.14 log), a value significantly higher than the protection elicited by the co-delivery of two plasmids (pCIOmp31+pcDNABLS) (2.20log) or by the Rev.1 vaccine (2.42 log). Mice vaccinated with pCIOmp31 exhibited a significant protection (2.24 log) against B. ovis; pcDNABLS induced 1.94log units of protection. pCIBLSOmp31 induced significantly higher protection (1.77log) against B. melitensis than pCIOmp31 plus pcDNABLS (1.09log) and similar protection than Rev.1 (2.30 log). Mice given pCIOmp31 exhibited a significant degree of protection(1.44 log) against B. melitensis as was against B. melitensis (1.44 log), while pcDNABLS induced 1.22 log protection. Together these results show that the chimera significantly increases protection elicited against B. ovis with respect to either pcDNABLS, pCIOmp31 or Rev.1 and induces a similar degree of protection against B. melitensis infection than Rev.1 vaccination.

Mouse Response

• Persistence: A bp26 mutant is attenuated in mice (Cloeckaert et al., 2004).
• Efficacy: A bp26 mutant induces significant protection in mice from challenge with wild type B. melitensis (Cloeckaert et al., 2004).

Mouse Response

• Persistence: A mucR mutant has a significantly reduced degree of colonization in mice (Arenas-Gamboa et al., 2011).
• Efficacy: A mucR mutant of 16M protected against challenge with wild type B. melitensis 16M (Arenas-Gamboa et al., 2011).

Mouse Response

• Persistence: An omp25 mutant is attenuated in mice (Edmonds et al., 2002).
• Efficacy: An omp25 mutant induces protection from challenge with wild type Brucella melitensis (Edmonds et al., 2002).

Mouse Response

• Persistence: An omp31 mutant is attenuated in mice (Cloeckaert et al., 2004).
• Efficacy: An omp31 mutant induces significant protection in mice from challenge with wild type B. melitensis (Cloeckaert et al., 2004).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Five groups of five female BALB/c mice, 9 weeks old, were immunized subcutaneously with one of the following treatments: (i) F68–CD–MP microparticles containing 20 μg of HS per mouse in 0.1 mL saline; (ii) free HS (20 μg/mouse); (iii) empty TROMS microparticles; (iv) 5 × 10^4 CFU/mouse of the living attenuated B. melitensis Rev1 reference vaccine strain; or (v) sterile buffered saline solution, the unvaccinated control group (Estevan et al., 2006).
• Challenge Protocol: Eight weeks after vaccination, the mice were challenged by the intraperitoneal route with 1 × 10^5 CFU of B. melitensis H38 virulent strain. Two weeks after the challenge, the animals were euthanatised by cervical dislocation. The spleens of the animals were aseptically removed, individually homogenized in BSS, properly diluted, and plated in Blood Agar Base medium for viable counts (Estevan et al., 2006).
• Efficacy: A single dose administered s.c. 8 weeks before infection produced significant protection with respect to unvaccinated control mice. Moreover, this protection was similar to that conferred by B. melitensis Rev1 reference vaccine. In contrast, no significant protection was obtained when non-encapsulated HS was given to mice (Estevan et al., 2006).

Mouse Response

• Host Strain: Balb/c
• Vaccination Protocol: Female BALB/c mice of 6 to 8-weeks old were used for the testing of these vaccines. Mice were anaesthetized with methoxyfuorane and immunized by the intraperitoneal route with (i) 30 μg of rSurA, (ii) 30 μg of rDnaK, (iii) rSurA + rDnaK (30 μg + 30 μg) or iv) PBS, which was the negative control. Antigens and PBS were administered mixed with Complete Freund's Adjuvant (CFA) on day 0 and with Incomplete Freund's Adjuvant (IFA) on day 15. A fifth group of mice was immunized i.p with 30 μg rDnaK in PBS without no adjuvant on days 0 and 15. As reference vaccinated controls other groups were immunized once (i) by the subcutaneous route at day 0 with 8 × 10^8 formalin-killed B. melitensis H38S in IFA or (ii) i.p with 1 × 10^4 live B. abortus S19. Two separate assays of immunization were performed. The first experiment included groups immunized with rDnaK plus adjuvant, rDnaK without adjuvant, rSurA, and the negative (PBS) and reference (H38) control groups. The second experiment included groups immunized with rDnaK, rSurA, and rDnaK + rSurA, all with adjuvant, and the negative (PBS) and reference (B. abortus S19) control groups. Sera for antibody detection were obtained by retro-orbital bleeding under anaesthesia at 15, 30, 45 and 75 days after the first immunization (Delpino et al., 2007).
• Immune Response: Immunization with rSurA elicited a vigorous IgG response that was detectable after the first immunization, increased further after the second Ag injection. PBS-immunized animals challenged with B. abortus 2308 developed antibodies against rSurA at 1 month after infection. Anti-rSurA IgG2a titers were higher than IgG1 titers during the whole immunization. rSurA stimulated significant production of IFN-γ, IL-2, IL-4 and IL-5 in spleen cells from rSurA-immunized animals but not from the PBS control group. All animals immunized with rDnaK alone elicited a humoral immune response that was detectable 15 days after the first immunization and increased further after the second injection to reach an IgG mean titer of 217,000 at day 30 post-vaccination. Immunization with rDnaK plus adjuvant induced similar anti-rDnaK IgG titers than immunization with rDnaK alone. None of the animals inoculated with PBS showed specific anti-rDnaK Abs at the time of challenge but notably, 30 days after infection all of them produced anti-rDnaK. Stimulation with rDnaK induced a significant production of IFN-γ and IL-2 in spleen cells from all mice immunized with rDnaK plus adjuvant Cells from rDnaK alone- or PBS-immunized mice were unable to stimulate the secretion of IFN-γ, IL-2, IL-4, IL-5 or IL-10 in response to rDnaK (Delpino et al., 2007).
• Challenge Protocol: Immunized mice were challenged by i.p. injection with 1 × 10^4 B. abortus 2308 (Delpino et al., 2007).
• Efficacy: Mice given rSurA or rDnaK plus adjuvant exhibited a significant degree of protection against B. abortus when compared with controls receiving PBS. Formalin-killed B. melitensis H38S, the control vaccine, induced 2.19 units of protection against B. abortus. Immunization with rDnaK alone induced a low but still significant level of protection. In a second experiment, both evaluated vaccines (rDnaK or rSurA plus adjuvant) induced significant protection against B. abortus infection. There was no additive protection by the simultaneous immunization with both rDnaK and rSurA. All evaluated vaccines induced less protection than H38 or B. abortus strain 19 control vaccines. Altogether these results indicate that rSurA or rDnaK in adjuvant induce partial protection against B. abortus infection (Delpino et al., 2007).
• Host Ifng (Interferon gamma) response
  • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IFN-gamma than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
  • Detailed Gene Information: Click Here.
• Host Il2 response
  • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IL-2 than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
  • Detailed Gene Information: Click Here.
• Host Il4 (interleukin 4) response
  • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IL-4 than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
  • Detailed Gene Information: Click Here.
• Host Il5 response
  • Description: Spleen cells from mice were used to determine cytokine levels 1 month after last immunization. Mice immunized with rSurA and stimulated with SurA had significantly higher levels of IL-5 than did mice immunized with PBS and stimulated with SurA (Delpino et al., 2007b).
  • Detailed Gene Information: Click Here.

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Female BALB/c mice were distributed into two groups: each mouse in one group was inoculated intramuscularly with 100 μg of pcDNA3.1-L7/L12-Omp16, pcDNA3.1-L7/L12, or pcDNA3.1-Omp16 in 100 μl of PBS. A control group was also used in this group, and these mice were infected with PBS or the pcDNA3.1 expression vector alone. Each mouse in the other group was injected with 10 μg of rL7/L12-Omp16 in 100 μl PBS according to the same schedule. Every mouse in this group was injected on weeks 0, 2, and 4. The mice used as positive controls were inoculated intraperitoneally on day 0 with 2× 10^8 CFU of B. abortus strain RB51 in 0.2 ml of PBS (Luo et al., 2006b).
• Immune Response: The results showed that the total IgG titer of the hyperimmune sera from mice immunized with pcDNA3.1-L7/L12-Omp16, pcDNA3.1-L7/L12, or pcDNA3.1-Omp16 reached 1:1,000, 1:800, or 1:600, respectively. Immunization with rL7/L12 and live RB51 strain elicited much higher humoral immune responses in mice, with IgG titers reaching 1:25,600 and 1:50,000, respectively. The analysis of IgG subtypes showed a significant increase in IgG1 and IgG2a from the DNA vaccine group, fusion protein vaccine group, and live RB51 group compared with the pcDNA3.1 vector control (Luo et al., 2006b).
• Challenge Protocol: Five mice from each group were challenged intraperitoneally 14 days after initial immunization. These mice were given a higher dose of strain 544, 5 × 10^5 CFU (Luo et al., 2006b).
• Efficacy: Immunization with any type of DNA vaccine resulted in a significantly higher degree of protection than the controls that received only PBS. Within the three recombinant DNA vaccines, the divalent DNA vaccine provided a higher protection level than either of the univalent DNA vaccines. Immunization with the recombinant fusion protein rL7/L12 also created significant protection. This protective effect was significantly lower than that created by theimmunization with the DNA vaccines (Luo et al., 2006b).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Four-to-six-week-old female Balb/c mice were randomly distributed into eight experimental groups so that each group consisted of 20 animals. Each group consisted of 20 animals. Various groups of mice were injected separately through subcutaneous route, on days 0,21, and 28 with escheriosome entrapped rL7/L12 (E-Lip-L7), egg PC/Chol liposome entrapped rL7/L12 protein (P-Lip-L7), rL7/L12 protein with Complete Freund’s adjuvant (IFA-L7), rL7/L12 protein alone (free form; F-L7), E. coli lipid sham liposome and sham escheriosome mixed with free rL7/L12 protein, a physical mixture (EL + L7). The positive control in this study were mice vaccinated with about 5 x 10^6 cfu of Brucella S-19. The negative control for this study received only PBS. Each animal was immunized with a priming dose of 50 micrograms of rL7/L12 protein per animal (day 0) and boosted with 30 micrograms per animal (days 21 and 28) (Mallick et al., 2007).
• Immune Response: Analysis of the mouse sera revealed non-significant antibody titre up to day 14 post-immunization in various groups of immunized mice. Significantly higher titre of IgG was detected on day 21 post-immunization in sera of animals which were primed with E-Lip-L7 form of the antigen as compared with the P-Lip-L7. Antibody titre was significantly less in the animals immunized with S-19 or IFA-L7 combination. High antibody response was maintained in E-Lip-L7 immunized mice following each booster with maximum antibody level on seventh day after the last immunization as compared with P-Lip-L7 group which was unable to rise to that extent. The antibody response evoked by S-19 or IFA-L7 was significantly less as compared to E-Lip-L7 immunized group. It was observed that E-Lip-L7 maintained significantly higher titer of IgG1 and IgG2a as compared with P-Lip-L7-immunized group. Both S-19 as well as IFA-L7 combination failed to induce significant level of IgG1 and IgG2a titre in the serum after 42 days post-first immunization and the trend was maintained even after day 60 post-immunization (Mallick et al., 2007).
• Challenge Protocol: One week after the final immunization, the mice belonging to various groups were challenged with 2 x 10^5 cfu of a virulent culture of B. abortus 544 intraperitoneally in 0.2ml
  of saline solution. After 7, 15 and 30 days post-challenge, four mice from each group were euthanatized and their spleens were analyzed (Mallick et al., 2007).
• Efficacy: Escherischia coli escheriosome-mediated cytosolic delivery of recombinant rL7/L12 protein can elicit strong immunological responses in the Balb/c mice. However, egg PC/Chol liposome entrapped rL7/L12 was found to impart relatively poor immune response. Escheriosome-entrapped rL7/L12 protein elicited high IgG2a isotype response, suggestive of its relevance in imparting protection against brucellosis in mice(Mallick et al., 2007).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Experiments were conducted with 7- to 9-week-old age-matched mice. 0.2 ml of vaccine was administered to mice via intraperitoneal injection (Yang et al., 2006).
• Persistence: Compared to wild-type strain 2308, splenic CFU in B. abortus ΔznuA-dosed mice were significantly decreased at weeks 1, 4, and 8. Importantly, by week 8, in three of the five B. abortus ΔznuA-dosed mice, splenic CFU could not be detected (Yang et al., 2006).
• Challenge Protocol: For challenge study, B. abortus 2308 was diluted in sterile PBS, in which 100 μl of bacterial suspension contained 5 × 10^4 CFU bacteria, and immunized and naive mice were subsequently challenged intraperitoneally. The challenge dose was confirmed by plating B. abortus on PIA (Yang et al., 2006).
• Efficacy: The results showed that the ΔznuA mutant was mostly cleared by 8 weeks postinfection. Splenic CFU detected 4 weeks postchallenge were all wild type, and none were from the ΔznuA mutant. Protection against wild-type B. abortus 2308 challenge was as effective as that obtained with the RB51 or S19 vaccine strain, so this mutant is a potential live vaccine (Yang et al., 2006).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Sixty female BALB/c mice were randomly distributed into groups of 10 for intraperitoneally (IP) vaccination. Each animal was given a single dose of microcapsules containing 1 x 10^5 CFU of either: encapsulated B. melitensis mutant vjbR::Tn5 in alginate (vjbR::Tn5/alginate), encapsulated vjbR::Tn5 in alginate with VpB inside the capsule (vjbR::Tn5/VpB core), or encapsulated vjbR::Tn5 in alginate with VpB in the shell of the sphere (vjbR::Tn5/VpB shell). The control groups received 1 x 10^5 CFU of either nonencapsulated vjbR::Tn5, empty capsules (no bacteria entrapped), or two hundred microliters of MOPS buffer (Arenas-Gamboa et al., 2008).
• Persistence: There appears to be a brief period between week one and two during which the organism replicates and the numbers of B. melitensis vjbR::Tn5 in the spleen increase, but by three weeks post-inoculation the number of organisms in the spleen exhibits a drastic decline and drops below the level of detection by four weeks post-infection (Arenas-Gamboa et al., 2008).
• Immune Response: Immunization with BM vjbR::Tn5 elicited an IgG response that was clearly detectable after 2 weeks post-vaccination for either encapsulated or nonencapsulated vaccines. In mice vaccinated with the nonencapsulated BM vjbR::Tn5 vaccine, IgG levels peaked at 8 weeks post-immunization, whereas IgG responses in mice immunized with the BM vjbR::Tn5 with VpB in the shell, levels increased steadily and reached a maximum after 18 weeks post immunization. In this case, an induction of higher and sustained antibody levels correlated with enhanced protection for both BM vjbR::Tn5 in alginate and vjbR::Tn5 in VpB shell formulations. Mice vaccinated with the encapsulated vjbR::Tn5 revealed elevated secretion from spleen cells of INF-γ, IL-12, but no IL-4. These suggested an induction of a T helper 1 (Th1) response reflecting the enhanced immunity associated with microencapsulation (Arenas-Gamboa et al., 2008).
• Challenge Protocol: At certian times after vaccination, mice were challenged IP using 1 x 10^5 CFU/mouse of B.melitensis wild-type 16M. One week post challenge, mice were euthanizediation and their spleens were removed .
• Efficacy: A single immunization dose in BALB/c mice with the encapsulated vjbR mutant improved protection against wild-type B. melitensis 16M challenge compared to the nonencapsulated vaccine strain (P<0.05) .
• Host Ifng (Interferon gamma) response
  • Description: Cytokine secretion from spleen cells of mice vaccinated with the encapsulated vjbR::Tn5 revealed significantly elevated secretion of gamma interferon compared to non-vaccinated mice 10 and 30 weeks post vaccination (Arenas-Gamboa et al., 2008).
  • Detailed Gene Information: Click Here.
• Host Il12b response
  • Description: Cytokine secretion from spleen cells of mice vaccinated with the encapsulated vjbR::Tn5 revealed significantly elevated secretion of interleukin-12 compared to non-vaccinated mice 10 and 30 weeks post vaccination (Arenas-Gamboa et al., 2008).
  • Detailed Gene Information: Click Here.

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Mice were immunized with 3 doses (at 2 week intervals) of heat-killed bacteria (1 x 10^9 CFU per dose) mixed with adjuvant and administered subcutaneously in the back or with 3 doses of CYTs administered intraperitoneally. Control groups received PBS. The Brucella group was immunized with B. Melitensis H38 (Delpino et al., 2007a).
• Persistence: Not noted.
• Immune Response: Subcutaneous immunization with with heat-killed bacteria elicited a strong antobody response against CYT antigens. Antibody levels were highest after the second immunization, in most cases. In mice immunized with nonpathogenic species. Anti-Brucella antibody levels were augmented in all groups compared to preimmunization levels (Delpino et al., 2007a).
• Challenge Protocol: One month after the final immunization, mice were challenged intravenously with 1.3 x 10^4 CFU of live B. abortus 2308. The mice were killed 30 days later and had their spleens analyzed and plated (Delpino et al., 2007)
• Efficacy: Cross-reacting anibodies were detected in serum samples obtained at the moment of challenge in all groups of mice. Spleen counts were significantly lower in immunized mice than in mice injected with PBS. Protection levels for nonpathogenic bacteria were lower than that obtained with Brucella immunization . Counts of CFU in mice immunized with B. melitensis were significantly lower than those of mice immunized with any other bacteria. Anti-brucella antibodies were detected in all groups 30 days postchallenge at levels similar to those found at the moment of challenge (Delpino et al., 2007a).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Two separate experiments of oral immunization were performed. Mice were inoculated intragastrically at weekly intervals with three doses of live NPAP(1 x 10^8 CFU) or heat-killed B. abortus (HKBA) strain 2308 (1 x 10^8 CFU)or PBS by an intragastric feeding tube (Delpino et al., 2007a).
• Persistence: Not noted.
• Immune Response: Anti-Brucella IgG levels were significatly higher than preinfection levels in all groups of mice infected with NPAP. Mice infected with HKBA exhibited a significant rise in anti-Brucella IgG in serum. No significant increase in IgA was detected at the time of challenge for mice immunized with HKBA or infected with NPAP (Delpino et al., 2007a).
• Challenge Protocol: Twenty days after the last infecting dose, mice were challenged by the same route with live B. abortus 2308 (Delpino et al., 2007a).
• Efficacy: Serum levels of anti-Brucella IgA increased significantly in mice previously infected with O. anthropi and in mice orally infected with HKBA. Fecal levels of anti-Brucella IgA also increased after challenge (Delpino et al., 2007a).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Five week-old female mice were used. The mice were vaccinated subcutaneously. Blood samples were taken on one or more occasions during the course of some experiments. Quantitative cultures for viable B. abortus were performed on spleens at 1 and 4 weeks postinfection. Each mouse was vaccinated with 30 micrograms of porin-S-LPS (Winter et al., 1988).
• Immune Response: Protective vaccines caused the formation of increased concentrations of circulating O-polysaccharide-specific antibodies, although there were individual exceptions to the quantitative associatiQn between O-polysaccharide-specific antibodies and protection. Antibodies specific for porin or R-LPS were found in negligible quantities in vaccinated mice (Winter et al., 1988).
• Challenge Protocol: B. abortus smooth strain 2308 of known virulence was used for challenge infections. In some experiments, vaccination or challenge was performed with vaccine strain 19. Animals were challenged 4 weeks postinfection with approximnately 5 x 10^4 CFU of live B. abortus cells (Winter et al., 1988).
• Efficacy: Vaccination with porin-S-LPS conferred significant protection against challenge infections with either B. abortus 2308 or 19 at both 1 and 4 weeks postinfection. The magnitude of protection was not significantly enhanced at either time period by the inclusion of TDM and MDP adjuvant in the vaccine. In contrast, vaccination with the same quantity of porin-R-LPS with or without adjuvant provided no significant protection against either challenge strain (Winter et al., 1988).

Mouse Response

• Host Strain: BALB/c mice
• Vaccination Protocol: RB51SOD was used to vaccinate mice with a dose of ~4 x 10^8 cfu per mouse.
• Persistence: The presence of the Cu/Zn SOD plasmid in strain RB51 does not alter its vaccine efficacy. Overexpression of SOD does not alter the attenuation characteristic of strain RB51 (Vemulapalli et al., 2000a).
• Vaccine Immune Response Type: VO_0003068
• Side Effects: None observed.
• Efficacy: Recombinant strain RB51SOD in mice induces better protection against virulent B. abortus infection compared to B. abortus vaccine strain RB51 (Vemulapalli et al., 2000a).
  
• Description: Mice vaccinated with RB51SOD, but not RB51, develop antibodies and cell-mediated immune responses to Cu/Zn SOD (Vemulapalli et al., 2000a).
  
• Host Ifng (Interferon gamma) response
  • Description: Mice vaccinated with strain RB51SOD developed a Th1 immune response to the CuZn SOD, indicated by specific induction of serum IgG2a antibodies, but not IgG1 antibodies. IFN-gamma , but not IL -4 is secreted by CuZn SOD-stimulated splenocytes (Vemulapalli et al., 2000a). The enhanced protective immunity conferred by strain RB51SOD my be attributed to the specific cell-mediated responses, especially IFN-gamma secretion (Vemulapalli et al., 2000a).
  • Detailed Gene Information: Click Here.

Mouse Response

• Vaccination Protocol: Groups of 13 mice each were vaccinated by intraperitoneal (i.p.) inoculation of viable strains RB51 (3 × 10^8 CFU/mouse), RB51SOD (5 × 10^8 CFU/mouse), RB51WboA (2.5 × 10^8 CFU/mouse) and RB51SOD/WboA (2.8 × 10^8 CFU/mouse) (Vemulapalli et al., 2004).
• Persistence: No bacteria were isolated from the strain RB51WboA- and RB51SOD/WboA vaccinated mice at the time of challenge (Vemulapalli et al., 2004).
• Challenge Protocol: Seven weeks after vaccination, five mice from each group were challenged i.p. with 3 × 10^4 CFU/mouse of virulent B. abortus 2308, and the remaining five mice were challenged i.p. with 2.4 × 10^4 CFU/mouse of virulent B. melitensis 16 M. Two weeks after challenge, the mice were euthanized and the number of CFUs in their spleens were determined (Vemulapalli et al., 2004).
• Efficacy: Mice vaccinated with strains RB51 and RB51SOD showed significant protection in comparison to control. Mice vaccinated with strain RB51SOD showed a significantly better protection (mean reduction in CFU/spleen = 2.9 logs) than the mice vaccinated with strain RB51 (mean reduction in CFU/spleen = 1 log) (P = 0.02). No bacteria were isolated from the strain RB51WboA- and RB51SOD/WboA vaccinated mice, indicating that these mice developed a superior immunity that prevented the infection of B. abortus 2308 (Vemulapalli et al., 2004).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Female BALB/c mice of 6 to 8-weeks old were used for the testing of these vaccines. Mice were anaesthetized with methoxyfuorane and immunized by the intraperitoneal route with (i) 30 μg of rSurA, (ii) 30 μg of rDnaK, (iii) rSurA + rDnaK (30 μg + 30 μg) or iv) PBS, which was the negative control. Antigens and PBS were administered mixed with Complete Freund's Adjuvant (CFA) on day 0 and with Incomplete Freund's Adjuvant (IFA) on day 15. A fifth group of mice was immunized i.p with 30 μg rDnaK in PBS without no adjuvant on days 0 and 15. As reference vaccinated controls other groups were immunized once (i) by the subcutaneous route at day 0 with 8 × 10^8 formalin-killed B. melitensis H38S in IFA or (ii) i.p with 1 × 10^4 live B. abortus S19. Two separate assays of immunization were performed. The first experiment included groups immunized with rDnaK plus adjuvant, rDnaK without adjuvant, rSurA, and the negative (PBS) and reference (H38) control groups. The second experiment included groups immunized with rDnaK, rSurA, and rDnaK + rSurA, all with adjuvant, and the negative (PBS) and reference (B. abortus S19) control groups. Sera for antibody detection were obtained by retro-orbital bleeding under anaesthesia at 15, 30, 45 and 75 days after the first immunization (Delpino et al., 2007b).
• Immune Response: Immunization with rSurA elicited a vigorous IgG response that was detectable after the first immunization, increased further after the second Ag injection. PBS-immunized animals challenged with B. abortus 2308 developed antibodies against rSurA at 1 month after infection. Anti-rSurA IgG2a titers were higher than IgG1 titers during the whole immunization. rSurA stimulated significant production of IFN-γ, IL-2, IL-4 and IL-5 in spleen cells from rSurA-immunized animals but not from the PBS control group. All animals immunized with rDnaK alone elicited a humoral immune response that was detectable 15 days after the first immunization and increased further after the second injection to reach an IgG mean titer of 217,000 at day 30 post-vaccination. Immunization with rDnaK plus adjuvant induced similar anti-rDnaK IgG titers than immunization with rDnaK alone. None of the animals inoculated with PBS showed specific anti-rDnaK Abs at the time of challenge but notably, 30 days after infection all of them produced anti-rDnaK. Stimulation with rDnaK induced a significant production of IFN-γ and IL-2 in spleen cells from all mice immunized with rDnaK plus adjuvant Cells from rDnaK alone- or PBS-immunized mice were unable to stimulate the secretion of IFN-γ, IL-2, IL-4, IL-5 or IL-10 in response to rDnaK (Delpino et al., 2007b).
• Challenge Protocol: Immunized mice were challenged by i.p. injection with 1 × 104 B. abortus 2308 (Delpino et al., 2007b).
• Efficacy: Mice given rSurA or rDnaK plus adjuvant exhibited a significant degree of protection against B. abortus when compared with controls receiving PBS. Formalin-killed B. melitensis H38S, the control vaccine, induced 2.19 units of protection against B. abortus. Immunization with rDnaK alone induced a low but still significant level of protection. In a second experiment, both evaluated vaccines (rDnaK or rSurA plus adjuvant) induced significant protection against B. abortus infection. There was no additive protection by the simultaneous immunization with both rDnaK and rSurA. All evaluated vaccines induced less protection than H38 or B. abortus strain 19 control vaccines. Altogether these results indicate that rSurA or rDnaK in adjuvant induce partial protection against B. abortus infection (Delpino et al., 2007b).

Mouse Response

• Vaccination Protocol: Mice (eight/group) were anaesthetized with methoxyfuorane and immunized by the intraperitoneal route with 30
• Immune Response: Immunization with recombinant BLSOmp31 elicited a strong specific IgG response that was detectable after the first immunization, increased after the second boost and reached IgG mean titers of 78,400 or 26,000 (anti-rOmp31 and anti-Omp31(48–74) , respectively) at the time of bacterial challenge. Immunizatio with rBLSOmp31 elicited high levels of anti-Omp31 IgG1 as well as IgG2a antibodies (IgG1 mean titer: 17,600; IgG2a mean titer: 5300). IgG1 titers predominated over IgG2a titers during the whole immunization schedule for both recombinant antigens. The elicited anti-peptide antibodies recognized the recombinant Omp31 as well as the native membrane protein, as demonstrated by the reactivity of the sera against whole rough B. ovis bacteria. These antibodies also produced complement mediated B. ovis cells lysis (Cassataro et al., 2007).
• Challenge Protocol: Immunized mice were challenged, by intravenous injection, with 1×10^4 B. melitensis H38S or 1×10^4 B. ovis. Mice were killed by cervical dislocation 30 days after being challenged and their spleens were removed aseptically. Each spleen was homogenized in a stomacher bag, serially diluted, plated on supplemented TSA yeast extract (TSA-YE) and incubated (Cassataro et al., 2007).
• Efficacy: The chimera significantly increases the protection elicited against B. ovis with respect to either BLS or Omp31. In fact, rBLSOmp31 induced the highest protection level (2.45 log) against B. ovis, which was only comparable with that induced by the control vaccine (2.42 log), but significantly higher (P < 0.01) than the vaccination with rBLS plus Omp31(48–74) (1.08 log) (Cassataro et al., 2007).

Mouse Response

• Vaccination Protocol: Experiment 1 (Exp. 1):
  Groups of eight mice were inoculated (i.p.) with either saline (negative control), B. abortus strain RB51 (2×10^8 CFU/mouse; positive control), recombinant B. abortus strain RB51SOD (2×108 CFU/mouse; positive control), O. anthropi 49237 (5×10^8 CFU/mouse), O. anthropi 49237pBB (5 × 108 CFU/mouse), or O. anthropi 49237SOD (5×10^8 CFU/mouse). At 2, 4, and 6 weeks after inoculation, three mice from each group were bled retroorbitally. The sera obtained were stored at −40°C until use in an enzyme-linked immunosorbent assay (ELISA) or for Western blot analysis.
  
  In a second experiment (Exp. 2) whether multiple injections were required for protection was asessed . Groups of five mice were immunized i.p. with either saline, B. abortus strain RB51, or O. anthropi 49237SOD at the doses described above. After two weeks, mice inoculated with O. anthropi 49237SOD were reimmunized with O. anthropi 49237/SOD (5×10^8 CFU/mouse). To determine whether different doses influenced the results of protection, four groups of five mice each were inoculated with O. anthropi 49237 at four different doses: 5×10^8, 5×10^7, 5×10^6, and 5×10^5 CFU/mouse. A fifth group (five mice) was inoculated i.p. with saline as negative control. Synthetic CpG-containing oligodeoxynucleotides (CpG-ODN) were administered to group four as an immunostimulatory adjuvant. One group (eight mice) was inoculated i.p. with O. anthropi strain 49237 (5×10^8 CFU/mouse); one group with strain 49237 (5×10^8 CFU/mouse) and CpG adjuvant, one group with strain 49237SOD alone (5×10^8 CFU/mouse), and one group with strain 49237SOD (5×10^8 CFU/mouse) and CpG adjuvant. The CpG adjuvant (10 nmol) was administered i.p. 4 h before inoculation and again at the time of inoculation of the bacterial strains. Three groups of mice (eight/group) served as controls and were inoculated with saline alone, CpG-ODN alone, or E. coli DH5α (10^6 CFU/mouse) and CpG-ODN. The mice were bled at 2, 4, and 6 weeks after inoculation (He et al., 2002).
• Challenge Protocol: Six weeks after inoculation, mice (5) from each group were challenged i.p. with 2×10^4 CFU of virulent B. abortus 2308/mouse. The mice were sacrificed after two weeks. Their spleens were homogenized, and spleens from the dilutions were plated to determine the numbers of Brucella CFU per spleen. The remaining unchallenged mice (each group) were sacrificed 6 to 8 weeks postinoculation, and spleen cells collected for cell culture in vitro (He et al., 2002).

Cattle Response

• Vaccination Protocol: Mature female cattle were immunized with strain 19 ( 2x10^8 and 6x10^8 CFU respectively) and 6-12 month old calves with strain 19 ( 4x10^10 and 12x10^10 CFU ) . Mature females and calves were inoculated with sterile vaccine diluent and formed a non-vaccinated, in-contact control group (Geong et al., 2000).
• Challenge Protocol: Cattle were allowed to graze for 24 months under conditions where infection was possible (Geong et al., 2000).
• Efficacy: Of the 599 animals bled initially, 83.5, 72.6, 73.8 and 64.1%, respectively, were represented at 3, 6, 9 and 24 months post infection, respectively. No significant differences between the two villages in the percentage of animals presented at each sampling were found. During the trials, no difference was observed in the presenting of animals identified as seropositive and those identified as seronegative (Geong et al., 2000).

Cattle Response

• Host Strain: Crossbreed
• Vaccination Protocol: At Day 0 of the experiment, heifers in the vaccinated group were divided in two sub-groups: 12 heifers were vaccinated at Day 0 of the experiment and the remaining 8 heifers were vaccinated at the 60th day of gestation, with a 2 mL dose. The heifers of the control group received 2 mL of sterile saline solution (Poester et al., 2006).
• Immune Response: Sera from all animals of RB51 vaccinated and control groups did not show anti-Brucella antibodies on Days −30, 0, 15, and monthly thereafter until the day of challenge (Poester et al., 2006).
• Challenge Protocol: All animals were challenged with the virulent B. abortus strain 2308. Each heifer received a 3.0 × 10^7 CFU challenge per heifer (Poester et al., 2006).
• Efficacy: Vaccination with RB51 vaccine did not result in the production of any antibodies against the O-side chain of lipopolysaccharide. The results indicate that vaccination with RB51 prevented 59.4% of abortions, 58.6% of cow infections, and 61.0% of fetal infections. The relative risk revealed that non-vaccinated animals have 2.462 times higher risk of aborting than RB51-vaccinated animals (Poester et al., 2006).

Cattle Response

• Vaccination Protocol: Mass vaccination of the cattle population of 3 Azore islands (Terceira, S. Miguel and S. Jorge) targeted breeding herds with the RB51 vaccine supplied by CZ Veterinaria S.A (Pontevedra, Spain). It was administered to heifers or adult female cattle s.c. at 10–34 × 10^9/dose (2 ml). In herds still infected with an intra-herd incidence of more than 10% after 6 months, all adults were re-vaccinated, as were adjacent herds (Martins et al., 2009).
• Persistence: During the study period, supramammary (N = 303) and retro-pharyngeal (N = 342) lymph nodes and spleen (N = 298) samples from 343 sero-positive animals slaughtered due to brucellosis suspicion were submitted for culture. Brucella was isolated from 176 animals (51%). Similar isolation rates (39%) were observed for supramammary and retro-pharyngeal lymph nodes, but a lower rate was seen for spleen (7%) (Martins et al., 2009).
• Immune Response: During the study period, supramammary (N = 303) and retro-pharyngeal (N = 342) lymph nodes and spleen (N = 298) samples from 343 sero-positive animals slaughtered due to brucellosis suspicion were submitted for culture. Brucella was isolated from 176 animals (51%). Similar isolation rates (39%) were observed for supramammary and retro-pharyngeal lymph nodes, but a lower rate was seen for spleen (7%) (Martins et al., 2009).
• Side Effects: No side-effects, such as abortion were reported (passive reporting). The only outstanding observation that could be related to vaccination was a weak newborn calf from which RB51 was isolated. The annual number of human cases was also low (≤4) and none of them was due to RB51, but to field strain B. abortus biovar 1. It was impossible to relate the disease occurrence in humans with the prevalence in animals (Martins et al., 2009).
• Challenge Protocol: n/a (Martins et al., 2009)
• Efficacy: The overall trend is a regular decrease of the three parameters from the beginning of the vaccination programme up to the end of the study period. Average herd incidence, herd prevalence and animal prevalence decreased 69.26%, 39.26% and 75.41% respectively, from 2002 to 2007 for the whole area. Mean within-herd prevalence followed the same pattern, declining on a gradual pace until 2007 (Martins et al., 2009).
• Description: RB51 vaccine supplied by CZ Veterinaria S.A (Pontevedra, Spain) (Martins et al., 2009).

Cattle Response

• Vaccination Protocol: To establish the efficacy of RB51 in cattle, female calves were inoculated SC at 3, 5, 7, and 10 months, respectively with RB51 (n = 26), S19 (n = 22), or saline (n = 15) (Cheville, 2000).
• Persistence: B. abortus strain RB51 was cultured from biopsies of superficial cervical lymph nodes in heifers vaccinated with RB51 and S19 at 10 weeks, but not at 12 weeks (Cheville, 2000).
• Side Effects: In cattle, RB51 is less virulent than B. abortus cattle vaccine Strain 19.
• Challenge Protocol: Calves were bred at 16 to 17 months of age and challenged during the first pregnancy with virulent B. abortus (Cheville, 2000).
  
• Efficacy: After vaccination, heifers administered RB51 developed no serum antibodies that reacted in the agglutinate test , but yielded a positive dot -blot assay using RB51 antigen . B. abortus strain RB51 was cultured from biopsies of superficial cervical lymph nodes from cows challenged with RB51and S19 vaccines at 10 weeks , but not at 12 weeks. Three month old vaccinated heifers were protected from infection and abortion; strain 19-vaccinated heifers were not infected nor aborted. Control heifers were infected. Vaccination at five and seven months of age gave equivalent, but less than complete protection. Heifers given strain 19 (n = 16) were protected 95%; those given RB51 were 87% protected; controls (administered saline) (n = 15) exhibited a high incidence of infection and abortion. No significant differences in the efficacy of either vaccine was found in animals at any given age. However, when compared to controls marked differences in the efficacy of each vaccine were noted. No gross or microscopic evidence of brucellosis was found in the tissues and organs of cows not infected at birth (Cheville, 2000).
  
  All heifers vaccinated with RB51 at three months were protected against infection and abortion. Vaccination at five and seven months of age yielded equivalent protection. Heifers given strain 19 were 95% protected. In calves, the results obtained suggest that RB51 protects at dosage levels comparable to those of strain 19.(Cheville, 2000).
• Description: Strain RB51 is protective in cattle at doses comparable to those of strain 19 (Cheville, 2000). Brucella abortus strain RB51 is the vaccine of choice against brucellosis of cattle in the United States .

Goat Response

• Host Strain: Angora
• Vaccination Protocol: Four to five-year-old goats were used. Each goat received 1.5 x 10^9 cells of the bacteria subcutaneously in the left prescapular region. At 2,4,5,7,10,11, and 14 weeks the goats were sacrificed and tested for the presence of brucellae (ELBERG and FAUNCE, 1957).
• Persistence: At the third week organisms from the spleen, bone marrow, left and right prescapular regions, left and right supramammary nodes, right precrural and the mediastinal nodes were detected. By the fourteenth week, the infection in the single goat sacrificed was isolated to the left prescapular node. It was assumed that at this point the animals were free from infection (ELBERG and FAUNCE, 1957).
• Immune Response: The mutant strain stimulated an antibody-producing mechanism within the first ten days of vaccination. The antibody titers were highest at about 20 days postinfection (ELBERG and FAUNCE, 1957).
• Challenge Protocol: The challenge consisted of 33 ID doses of B. melitensis. It was administered 90 days after vaccination (ELBERG and FAUNCE, 1957).
• Efficacy: The vaccine was proven to be an effective immunizing agent for the host species tested (ELBERG and FAUNCE, 1957).

Sheep Response

• Vaccination Protocol: Seven groups, 22 sheep/group were either vaccinated subcutaneously (SC) or conjunctivally (CJ) (right eye) at the age of four months with the following actual doses, Rev.1, 1.1 × 10^9 CFU (SC) and 1.33 × 10^9 CFU (CJ); CGV26, 1.25 × 10^9 CFU (SC) and 1.22 × 10^9 cfu (CJ); CGV2631, 1.11 × 10^9 cfu (SC) and 1.30 × 10^9 cfu (CJ). The vaccine doses (<1 mL) were utilized where administered SC and 30 uL where administered CJ (Jacques et al., 2007).
• Challenge Protocol: One week before challenge, of 154 ewes, 99 of whiche were pregnant assesd by progesterone levels were were kept in a high security pen. Each ewe was challenged CJ (left eye) with 5.1 × 10^7 CFU of B. melitensis strain H38 after 76 days of pregnancy. Each animal was submitted to periodic immunological, clinical, and bacteriological tests and sacrificed 4–6 weeks after delivery. To follow cellular response, six ewes from each group were selected for further investigation (Jacques et al., 2007).
• Efficacy: Regardless of the route of administration of Rev.1 vaccine (SC or CJ), the results obtained agreed with those of previous studies [35], Rev.1 effectively protected ewes challenged at middle of pregnancy with 5 × 10^7 CFU of strain H38. In the control group (unvaccinated ewes), 100% aborted (Jacques et al., 2007).

Water buffalo Response

• Vaccination Protocol: Thirty Brucella-free female buffaloes were divided in three groups. Group A consisted of 10 non-pregnant water buffaloes 4–5 years old that were vaccinated once with RB51 (10.2 × 10^10 CFU/ml) during lactation. Group B consisted of 10 adult water buffaloes 28–36 months old at the first lactation that were previously vaccinated twice (4 weeks apart) as calves (6–9 months old) with 10.2 × 10^10 CFU/ml RB51, but were not revaccinated with RB51 as adults. Group C consisted of 5 adults 4–5 years old during the fourth month of lactation and 5 adult water buffaloes 28–36 months old at the first lactation that were not vaccinated (controls) (Longo et al., 2009).
• Side Effects: No side effects attributable to vaccine administration were noted in any treatment group. All the experimental water buffaloes appeared clinically normal throughout the study (Longo et al., 2009).
• Efficacy: RB51 was identified from milk samples collected during the first week post-vaccination (days 1 and 4) in 3/10 of the vaccinated animals of group A but was never isolated in groups B and C. Moreover, RB51 DNA was detected during the first week until the fourth week post-vaccination in the milk samples from group A but was not detected in milk samples of the animals of B and C (Longo et al., 2009).

Squirrel Response

• Host Strain: Richardson's ground squirrel
• Vaccination Protocol: Each Richardson’s ground squirrel received 250 µl of inoculum directly into the mouth via tuberculin syringe. All squirrels were observed twice daily for clinical signs for 21 days and once daily thereafter. RB51, strain 19 (S19), and virulent B. abortus strain 9941 (S9941) were administered orally to squirrels to further characterize B. abortus infection in this species. Six groups of nongravid ground squirrels were orally inoculated with 6 x 10^8 CFU RB51, 2.5 x 10^4 CFU S19, 2.5 x 10^7 CFU S19, 1.3 x 10^6 CFU S9941, 2.1 x 10^8 CFU S9941, or vaccine diluent (control) (Nol et al., 2009).
• Persistence: One of 5 animals in the lower-dose S19 group and 2 of 3 animals in the higher-dose S19 group showed persistence of bacteria in various tissues at 14 weeks post-inoculation (WPI). At 18 WPI, 1/5 animals in the RB51 group and 1/5 animals in the high-dose S9941 group were
  culture positive. There was a general lack of persistence of the three strains of B. abortus in Richardson’s ground squirrels at 18 wk PI (Nol et al., 2009).
• Immune Response: On examination, all livers displayed hepatocellular vacuolization with a pronounced centrilobular pattern consistent with lipidosis and occasional multifocal areas of pleocellular infiltrates consisting of small and large mononuclear cells, suggesting mild hepatitis. One animal in the RB51 group also had focal necrotizing hepatitis. Other lesions observed in these animals included multifocal interstitial pyogranulomatous nephritis and nephrosis, focal necrotizing pancreatitis, and sparse mononuclear cellular infiltrates in the oviduct and uterus (Nol et al., 2009).
• Side Effects: There was no evidence of pathology caused by B. abortus strains in nonpregnant squirrels based on clinical signs, gross lesions, and microscopic lesions (Nol et al., 2009).
• Challenge Protocol: Richardson’s ground squirrels experience minimal clinical signs and pathology at challenge levels ranging from 2.5 x 10^4 CFU to 6 x 10^8 CFU (Nol et al., 2009).
• Efficacy: It is unknown if and when the three animals that were culture positive at 14 wk and the two positive animals at 18 wk may have cleared the infection if given more time. No evidence of shedding of RB51 or S19 beyond 2 days PI, and only 2/25 animals cultured at 18 wk showed evidence of persistent infection. Even if infected, squirrels are unlikely to be severely affected by B. abortus or serve as sources of Brucella in the field (Nol et al., 2009).
• Description: In summary, RB51, S19, and S9941 do not produce disease in nonpregnant Richardson’s ground squirrels when given orally at challenge doses ranging from 2.5 x 104 cfu to 6 x 108 cfu. This species is unlikely to act as a reservoir or source of infection for either vaccine or wild type strains of B. abortus. The Richardson’s ground squirrel would be a poor model for oral Brucella infection as well. These data provide useful information for researchers and those charged with the management of brucellosis in wildlife in the GYA (Nol et al., 2009).

Deer Response

• Host Strain: Red deer (Cervus elaphus)
• Vaccination Protocol: A novel approach of immunization was examined using alginate composite microspheres containing a non-immunogenic, eggshell-precursor protein of Fasciola hepatica (Vitelline protein B, VpB) to deliver live RB51. 54 1–2-yr-old female red deer (Cervus elaphus elaphus), used as a model for elk, were vaccinated orally (PO) or subcutaneously (SC) with 1.5 x 10^10 viable organisms per animal. Specifically, animals were randomly distributed into six different treatments (n=9/group). Three groups were inoculated SC with a total dose of 1.5 x 10^10 CFU of either nonencapsulated RB51, encapsulated RB51 with alginate, or encapsulated RB51 with alginate and VpB. Two groups were vaccinated PO; one group received 1.5 x 10^10 CFU of encapsulated RB51 with alginate, and the second group received with encapsulated RB51 with alginate and VpB. The control group received a SC injection of 1 ml of empty capsules (no bacteria entrapped). A single vaccination dose was given to all animals (Arenas-Gamboa et al., 2009).
• Persistence: At 12 wk postvaccination, animals that received the encapsulated vaccine with VpB in the formulation (regardless of the immunization route) were the only individuals that had a statistically significant proliferative response compared with the controls (P<0.0005 PO vaccinates, P<0.005 SC group; Fig. 2). Interestingly, the cpm counts in animals that received encapsulated RB51 with VpB PO were also higher than in deer that received the same formulation via SC (P<0.3). None of the animals that received nonencapsulated vaccine had a significant cellular response compared with naïve nonvaccinated animals. Immunization with RB51 elicited an anti-Brucella IgG response that was clearly detectable by 6 wk postvaccination. During the initial 17 wk, anti-Brucella IgG levels were higher in animals that received SC vaccine compared with the groups that were immunized PO. Between 17 to 28 wk, anti-Brucella IgG levels in animals that were PO-vaccinated had an increase in anti-Brucella IgG compared with deer SC-vaccinated (Arenas-Gamboa et al., 2009).
• Immune Response: Humoral responses post-vaccination (immunoglobulin G [IgG] levels), assessed at different time points, indicated that capsules containing live RB51 elicited an anti-Brucella specific IgG response. Furthermore, the encapsulated vaccine elicited a cell-mediated (CMI) response that the non-encapsulated vaccinates failed to produce (Arenas-Gamboa et al., 2009).
• Challenge Protocol: At 7 mo postvaccination, three to four red deer from each vaccination group (except RB51/alginate SC; n=2) were challenged with a dose of 1x10^9 B. abortus strain 19 organisms by conjunctival exposure. Dose exposure was confirmed by serial dilutions and plating onto TSA plates. At 2 wk post-challenge, animals were euthanized, and spleens were harvested, weighed and homogenized. At 3–5 days postincubation, bacteria were enumerated (Arenas-Gamboa et al., 2009).
• Efficacy: Only animals that received encapsulated RB51 vaccine (either route) exhibited significant reduction in bacterial counts in their spleens. These data suggest that alginate-VpB microspheres provide a method to enhance the RB51 vaccine performance in elk. At 2 wk postchallenge, only animals that received encapsulated SRB51 with VpB had a significant decrease in bacterial load in the spleen. Red deer that received the vaccine PO were the only group that was statistically significant compared with the nonencapsulated, injected RB51. Animals that were PO-immunized with the VpB capsules had a 1.27 log reduction in spleen counts compared with animals vaccinated with nonencapsulated RB51 and a 1.68 log reduction compared with naïve, nonvaccinated, but S19 exposed, animals. S19 spleen counts in deer that received the VpB capsules via SC were also diminished by 1.21 log compared with the nonencapsulated RB51 and by 1.62 log compared with non-RB51 vaccinated controls (Arenas-Gamboa et al., 2009).

Buffalo Response

• Host Strain: Bison (Bison bison)