• Vaccine Ontology ID: VO_0011377
• Type: Subunit vaccine
• Status: Research
• Antigen: B. pertussis brkA
• brkA gene engineering:
  • Type: Recombinant protein preparation
  • Description: Fraction BS was applied to a Mono Q Sepharose (Amersham, Biosciences) (0.5 mg protein per ml resin) previously equilibrated with 25 mM Tris–HCl, pH 8.0. Proteins were eluted with a NaCl gradient (0–1 M) in 25 mM Tris–HCl, pH 8.0, in 0.5 ml fractions at a flow rate of 1 ml/min. Elution was monitored at A280 nm. The fractions showing the same peak profile were pooled and eluted again under the same chromatography conditions. Samples were submitted to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (T = 12.5% in 0.75 M Tris, 0.2% SDS, pH 8.8) and electrophoresis was performed at 60 mA in 25 mM Tris, 0.192 M glycine, 0.1% SDS, pH 8.3. The gel was stained with silver nitrate and fractions showing a similar molecular mass profile were pooled, concentrated by centrifugation at 440 × g in Centrifugal Ultrafree-20 tubes, 10 kDa (Millipore), and their protein concentration was evaluated. Four pools were formed (P1, P2, P3, P4), and used for immunization of mice (Cainelli et al., 2007).
  • Detailed Gene Information: Click Here.
• Immunization Route: Subcutaneous injection

• Vaccine Ontology ID: VO_0011357
• Type: Subunit vaccine
• Status: Research
• Antigen: B. pertussis cpn60/60 kDa chaperonin
• cpn60 gene engineering:
  • Type: Recombinant protein preparation
  • Description: Fraction BS was applied to a Mono Q Sepharose (Amersham, Biosciences) (0.5 mg protein per ml resin) previously equilibrated with 25 mM Tris–HCl, pH 8.0. Proteins were eluted with a NaCl gradient (0–1 M) in 25 mM Tris–HCl, pH 8.0, in 0.5 ml fractions at a flow rate of 1 ml/min. Elution was monitored at A280 nm. The fractions showing the same peak profile were pooled and eluted again under the same chromatography conditions. Samples were submitted to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (T = 12.5% in 0.75 M Tris, 0.2% SDS, pH 8.8) and electrophoresis was performed at 60 mA in 25 mM Tris, 0.192 M glycine, 0.1% SDS, pH 8.3. The gel was stained with silver nitrate and fractions showing a similar molecular mass profile were pooled, concentrated by centrifugation at 440 × g in Centrifugal Ultrafree-20 tubes, 10 kDa (Millipore), and their protein concentration was evaluated. Four pools were formed (P1, P2, P3, P4), and used for immunization of mice (Cainelli et al., 2007).
  • Detailed Gene Information: Click Here.
• Immunization Route: Subcutaneous injection

• Vaccine Ontology ID: VO_0011359
• Type: Subunit vaccine
• Status: Research
• Antigen: B. pertussis secreted adenylate cyclase (cyaA)
• CyaA gene engineering:
  • Type: Recombinant protein preparation
  • Description: The AC was purified from culture supernatants using a camodulin affinity chromatography. The preparation consisted of two polypeptides of 45 and 43 kDa that are structurally related as described by Ladant et al (Guiso et al., 1989).
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0000127
• Immunization Route: Subcutaneous injection

• Vaccine Ontology ID: VO_0011391
• Type: DNA vaccine
• Status: Research
• Antigen: B. pertussis pertactin precursor prn2
• Prn gene engineering:
  • Type: DNA vaccine construction
  • Description: To construct a prn mutant, amplification of the region containing the whole prn2 gene of the CCHMC1 strain was performed using PRN-F GGCACAGGACCGGCGCGTGTTTCGCGCACGACTCT) and PRN-R (CGCGTGGTGCGCCTGAAAGGCGGCGATGCCTTCA) with attB adaptors. The PCR products were cloned into pDONR221 to obtain pDONR-PTXA1 and pDONR-PRN2 by site-specific recombination techniques using the Gateway cloning system (Invitrogen). The regions transferred into the pDONR221 plasmid were sequenced for verification. pDONR-PTXA1 or pDONR-PRN2 was mixed with pABB-CRS2 to obtain pABB-PTXA1 and pABB-PRN2 by using the Gateway cloning system. pABB-PTXA1 or pABB-PRN2 was introduced into E. coli SM10pir and mobilized into the B. pertussis strain Tohama by conjugation (Komatsu et al., 2010).
  • Detailed Gene Information: Click Here.
• Vector: DONR221 (Invitrogen, Carlsbad, CA) and pABB-CRS2 (Komatsu et al., 2010).
• Immunization Route: Subcutaneous injection

• Vaccine Ontology ID: VO_0004545
• Type: DNA vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• S1 gene engineering:
  • Type: DNA vaccine construction
  • Detailed Gene Information: Click Here.
• Vector: pcDNA.3.1(+) (Kamachi et al., 2003)
• Immunization Route: Gene gun

• Vaccine Ontology ID: VO_0011498
• Type: Subunit vaccine
• Status: Research
• Antigen: Combination of the B. pertussis 69-kDa outer membrane protein and filamentous hemagglutinin (fhaB)
• fhaB gene engineering:
  • Type: Recombinant protein preparation
  • Description: A crystal clear supernatant of 5-day-old static cultures containing proteolysis inhibitor was purified. To remove impurities, the FHA was precipitated by overnight dialysis against 25-30 volumes of buffer A at 4 C, and the precipitate was collected by centrifugation. The precipitated FHA was dissolved in the smallest possible volume of 40 mM B-alanine buffer at pH 3.5, clarified by centrifugation, and applied at room temperature at a flow of 30 ml/h to a Superose 12 column. The retained highly purified FHA was eluted (Novotny et al., 1991).
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0001241
  • Description: 4.0 ml Alhydrogel (Novotny et al., 1991).
• Immunization Route: Intramuscular injection (i.m.)

• Vaccine Ontology ID: VO_0011361
• Type: Subunit vaccine
• Status: Research
• Antigen: B. pertussis pertussis toxin (PTx)
• ptxE gene engineering:
  • Type: Recombinant protein preparation
  • Description: Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
  • Detailed Gene Information: Click Here.
• PtxA gene engineering:
  • Type: Recombinant protein preparation
  • Description: Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
  • Detailed Gene Information: Click Here.
• ptxB gene engineering:
  • Type: Recombinant protein preparation
  • Description: Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
  • Detailed Gene Information: Click Here.
• ptxC gene engineering:
  • Type: Recombinant protein preparation
  • Description: Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
  • Detailed Gene Information: Click Here.
• ptxD gene engineering:
  • Type: Recombinant protein preparation
  • Description: Vaccine is prepared by chemically modifying purified PT from culture supernatants with tetranitromethane (TNM). The lot was adsorbed to aluminum hydroxide (Alhydogel; Superfos, Vedbaek, Denmark) at a concentration of 50 μg of protein adsorbed to 4 mg per 1.0 ml. Animal doses (2.5, 0.5, and 0.1 μg) were prepared by making fivefold serial dilutions in aluminum hydroxide (4 mg/ml) diluent and given in a volume of 50 μl (Bruss and Siber, 2002).
  • Detailed Gene Information: Click Here.
• Adjuvant:
  • VO ID: VO_0000127
• Immunization Route: Intraperitoneal injection (i.p.)

• Vaccine Ontology ID: VO_0002807
• Type: Live, attenuated vaccine
• Status: Research
• aroA gene engineering:
  • Type: Gene mutation
  • Detailed Gene Information: Click Here.
• Preparation: A DNA fragment encoding a kanamycin resistance determinant was used to insertionally inactivate the cloned aroA gene of Bordetella pertussis in Escherichia coli K-12, and a conjugative shuttle vector system based on the suicide vector pRTP1 was used to deliver the mutations from E. coli back into B. pertussis CN2992FS and BP1. The aroA mutation was introduced by allelic exchange into the chromosome of B. pertussis, resulting in otherwise isogenic parental and aroA mutant pairs. The B. pertussis aroA mutants grew well on laboratory medium supplemented with aromatic compounds but failed to grow on unsupplemented medium (Roberts et al., 1990).
• Immunization Route: intracerebral challenge

• Vaccine Ontology ID: VO_0004608
• Type: Recombinant vector vaccine
• Status: Research
• Host Species as Laboratory Animal Model: Mouse
• Antigen: The pertussis toxin gene, which encodes a highly virulent toxin (Mielcarek et al., 2006).
• Vector: Bordetella pertussis BPZE, which is attenuated for 3 different toxins: the pertussis toxin, the dermonecrotic toxin, and the tracheal cytotoxins (Mielcarek et al., 2006).
• Immunization Route: intranasal immunization
• Virulence: The pertussis toxin itself if extremely virulent, but after thorough and careful attenuation, the virulence is basically gone (Mielcarek et al., 2006).
• Description: This is an intranasal vaccine because pathogenic B. pertussis colonizes the respiratory tract of humans. The vaccine itself has been shown to only need one inoculation in order to elicit protection, making it a good candidate to be a vaccine vector for other diseases (Mielcarek et al., 2006).

• Vaccine Ontology ID: VO_0002808
• Type: Live, attenuated vaccine
• Status: Research
• dnt gene engineering:
  • Type: Gene mutation
  • Detailed Gene Information: Click Here.
• Preparation: his strain was obtained by genetically inactivating pertussis toxin via two point mutations in the ptx gene, by deleting dnt encoding dermonecrotic toxin, and by replacing the B. pertussis ampG gene by Escherichia coli ampG, resulting in the removal of tracheal cytotoxin (Feunou et al., 2008).
• Immunization Route: intranasal immunization

• Vaccine Ontology ID: VO_0004790
• Type: Recombinant vector vaccine
• Status: Licensed
• Host Species for Licensed Use: Mouse
• Antigen: BCG vaccine with S1 subunit of detoxified B. pertussis toxin; PT-9K/129G (Nascimento et al., 2008).
• Immunization Route: Intramuscular injection (i.m.)

• Product Name: VC expressing B. pertussis TetC/Tcf
• Vaccine Ontology ID: VO_0004781
• Type: Recombinant vector vaccine
• Status: Research
• Host Species for Licensed Use: Baboon
• TcfA gene engineering:
  • Type: Recombinant protein preparation
  • Description: An attenuated strain of Vibrio cholerae was used as a carrier for the expression of heterologous antigens such as fragment C from tetanus toxin (TetC) and tracheal colonization factor from Bordetella pertussis (Tcf) (Chen et al., 1998).
  • Detailed Gene Information: Click Here.
• Preparation: An attenuated strain of Vibrio cholerae was used as a carrier for the expression of heterologous antigens such as fragment C from tetanus toxin (TetC) and tracheal colonization factor from Bordetella pertussis (Tcf) (Chen et al., 1998).
• Immunization Route: intranasal immunization

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Female BALB/c mice, 4–6 weeks old (Animal House of the Instituto Butantan) (9–15 mice/group) were subcutaneously injected three times at weekly intervals (days 0, 7, 14) with BS pools (P1, P2, P3, P4) (1 μg/0.1 ml/mouse), and two times (days 0 and 14) with 73 kDa or 60 kDa proteins (1 μg/0.1 ml/mouse) alone or mixed with Diphtheria-Pertussis-Tetanus (DPT) vaccine formulated without aluminum hydroxide (NA-DPT), (2 μl/mouse), (Instituto Butantan). Current DPT vaccine containing aluminum hydroxide (DPTBut) was used as control (2 μl/mouse) (Lot no. 0008147/0 and 0309132, Instituto Butantan). Non-immunized mice (injected with physiologic saline) were used as control (Cainelli et al., 2007).
• Challenge Protocol: Animals were challenged by intracerebral route (i.c.) with live B. pertussis (strain 18323, NIH, USA), 21 days after the first immunization. Each mouse was inoculated with 30,000 live bacteria. Deaths were recorded until day 15 (Cainelli et al., 2007).
• Efficacy: High levels of antibodies were induced, and a 78% protection rate of mice challenged with live B. pertussis was observed. The 73 kDa N-terminal alpha-domain of BrkA autotransporter protein, one protein identified in the fraction, stimulated antibodies against pertussis and induced a 42% protection rate against the challenge (Cainelli et al., 2007).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Female BALB/c mice, 4–6 weeks old (Animal House of the Instituto Butantan) (9–15 mice/group) were subcutaneously injected three times at weekly intervals (days 0, 7, 14) with BS pools (P1, P2, P3, P4) (1 μg/0.1 ml/mouse), and two times (days 0 and 14) with 73 kDa or 60 kDa proteins (1 μg/0.1 ml/mouse) alone or mixed with Diphtheria-Pertussis-Tetanus (DPT) vaccine formulated without aluminum hydroxide (NA-DPT), (2 μl/mouse), (Instituto Butantan). Current DPT vaccine containing aluminum hydroxide (DPTBut) was used as control (2 μl/mouse) (Lot no. 0008147/0 and 0309132, Instituto Butantan). Non-immunized mice (injected with physiologic saline) were used as control (Cainelli et al., 2007).
• Challenge Protocol: Animals were challenged by intracerebral route (i.c.) with live B. pertussis (strain 18323, NIH, USA), 21 days after the first immunization. Each mouse was inoculated with 30,000 live bacteria. Deaths were recorded until day 15 (Cainelli et al., 2007).
• Efficacy: High levels of antibodies were induced, and a 78% protection rate of mice challenged with live B. pertussis was observed. The Cpn60/60 kDa chaperonin, one protein identified in the fraction, stimulated antibodies against pertussis and induced a 42% protection rate against the challenge (Cainelli et al., 2007).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: For active immunizations, Balb/c mice were given, subcutaneously, 3,ug of purified AC adsorbed on aluminium hydroxide, three times, at one week intervals . The mice were bled 5 days after the last injection in order to assess the presence of circulating anti-AC antibodies . The lethal challenge was performed 9 days after the final injection (Guiso et al., 1989).
• Challenge Protocol: Bacterial suspension (50 pl) was injected intranasally to groups of 10 3-week-old female Balb/c mice (CERJ, St Berthevin, France), weighing 16±1 g . The LD 50 for the challenge inocula was determined daily by recording the number of dead mice . Pulmonary edema was quantified by lung weight (Guiso et al., 1989).
• Efficacy: Active immunization with purified B. pertussis secreted adenylate cyclase (cyaA) protect mice against a lethal respiratory challenge with B. pertussis or B. parapertussis (Guiso et al., 1989).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: 3.5-week-old female BALB/c mice (Japan SLC, Hamamatsu) were immunized by two subcutaneous injections of 0.25 SHDs (0.125 ml) over a 2-week interval (Komatsu et al., 2010).
• Challenge Protocol: Two weeks after the second immunization, 50 µl of a suspension containing approximately 6 x 10^6 CFU of B. pertussis was instilled intranasally into mice anesthetized by intraperitoneal injection with pentobarbital sodium (Nembutal; Abbott Laboratories, Abbott Park, IL). Two hours (day 0) or 2, 5, or 8 days after the challenge, the mice were euthanized by pentobarbital injection (Komatsu et al., 2010).
• Efficacy: While the vaccine was effective against all of the B. pertussis strains regardless of the allele expression pattern, the strain expressing ptxA1 and prn2 displayed a survival advantage over the other strains (Komatsu et al., 2010).

Mouse Response

• Vaccination Protocol: For immunization, 0.5 mg of gold particles were coated with 2 μg of plasmid DNA and 0.5 mg gold per injection was used. Mice were immunized intradermally three times on days 0, 14, and 28 using a Helios Gene Gun at a helium gas pressure of 400 psi (Kamachi et al., 2003).
• Immune Response: Gene gun vaccination was employed for the delivery of pcDNA/S1, and the induction of IgG1 predominant antibody production was observed (Kamachi et al., 2003).
• Challenge Protocol: Immunized BALB/c mice were challenged intranasally with B. pertussis strain 18–323 (Kamachi et al., 2003).
• Efficacy: In the pcDNA/S1-immune group, five out of 10 mice survived 24 hours after the challenge, whereas all of the mice in the pcDNA-immune group died within 24 hours (Kamachi et al., 2003).

Mouse Response

• Vaccination Protocol: Groups of mice were injected intraperitoneally with 0.5 ml volumes of four concentrations (Novotny et al., 1991).
• Challenge Protocol: Mice were challenged intracerebrally 14 days after antigen injection. The challenge dose contained 300-400 LD50, and a 1:1250 dilution of the challenge does contained ~ 10cfu. All mice were challenged within 90 minutes after the challenge suspension was thawed; the challenge was injected using a 1 ml syringe in a Hamilton PB600-I dispensor that reproducibly delivers 20-ul voumes (Novotny et al., 1991).
• Efficacy: A combination of the 69-kDa outer membrane protein and filamentous hemagglutinin (fhaB), both isolated from lymphocytosis promoting factor (LPF; pertussis toxin) minus mutants of Bordetella pertussis, is protective in the mouse intracerebral challenge potency (Kendrick) test (Novotny et al., 1991).

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: Mice were removed from their cages, weighed, and placed on a stainless steel rack that fits inside of the Plexiglas aerosol chamber (40 by 40 by 40 cm). The 21-h culture of B. pertussis was suspended in sterile PBS to a concentration of approximately 2 × 10^9 CFU/ml of inoculum. This inoculum was delivered to the mice using a standard nebulizer (model 647; Devilbis, Somerset, Pa.) with a set pressure of 1.5 kg/cm2. The chamber and the nebulizer were enclosed in a biosafety level-2 hood and certified prior to use to document that airflow barriers were maintained. Uniformity of aerosol in the chamber was maintained with the use of two PABST 900 series AC fans (Newark Supply, Newark, N.J.). The even dispersion of the aerosol was confirmed with a light laser (Bruss and Siber, 2002).
• Challenge Protocol: Mice were exposed to nebulization for 30 min and removed 30 min after termination of aerosol. The completion of the aerosol represented time 0. Mice were removed from the box and replaced into their cages. Cages were checked daily for mortality (Bruss and Siber, 2002).
• Efficacy: BALB/c mice were immunized with PTx vaccine on day 6 of life and then challenged with B. pertussis using the aerosol challenge model. These primed mice were significantly better protected against leukocytosis, weight loss, and proliferation of B. pertussis in the lungs following aerosol challenge than the nonprimed group. This protection correlated with levels of anti-PT antibody in serum present on the day of aerosol challenge (Bruss and Siber, 2002).

Mouse Response

• Persistence: The B. pertussis aroA mutants expressed the normal B. pertussis extracellular, virulence-associated proteins (Roberts et al., 1990).
• Efficacy: Mice exposed to three separate aerosols of live B. pertussis aroA bacteria were protected against lung colonization after being exposed to an aerosol containing the virulent parental B. pertussis strain. High-level antibodies against B. pertussis rapidly appeared in the sera of mice immunized by aerosol with the B. pertussis aroA strains and challenged with the virulent parent (Roberts et al., 1990).

Mouse Response

• Vaccination Protocol: The mice were vaccinated with highly-attenuated B. pertussis in order to prepare for challenge with virulent wild-type B. pertussis (Mielcarek et al., 2006).
• Vaccine Immune Response Type: VO_0000287
• Challenge Protocol: After the mice had been inoculated with attenuated B. pertussis (which after a month had colonized the entire mouse respiratory tract) they were challenged with virulent wild-type B. pertussis (Mielcarek et al., 2006).
• Efficacy: A single intranasal inoculation of mice with the B. pertussis vaccine vector induced the same level of protection, if not higher, as two injections of the commercial acellular vaccine (Mielcarek et al., 2006) .
• Description: Inoculation with the B. pertussis vaccine vector shows protective immunity which rivals that of the vaccines currently on the market.

Mouse Response

• Persistence: The dnt mutant in B. pertussis yielded a highly attenuated strain that was still able to transiently colonize the mouse respiratory tract [Ref1805:Feunou et al., 2008.
• Efficacy: A single intranasal administration of BPZE1(dnt mutant vaccine) induced full protection in adult mice (8 weeks old), as well as in infant mice (3 weeks old), whereas commercial acellular pertussis vaccine (aPV) only partially protected infant mice, even after repetitive doses (Feunou et al., 2008).

Mouse Response

• Vaccination Protocol: Mice were immunized with 50μl of one-tenth dose of an adult mouse of DTP at day 5 (or day 12 as specified) or 10^5 CFU of BCG or rBCG-S1PT on day 5 according to different regimens (Nascimento et al., 2008).
• Vaccine Immune Response Type: VO_0003057
• Challenge Protocol: Mice were subjected to intracerebral inoculation with a lethal dose of B. pertussis with approximately 3 x 10^4, 3 x 10^5, or 9 x 10^5 CFU (in 30μl) on day 21 after birth.
• Efficacy: A single dose of rBCG-S1PT at day 5 led to a 100% survival of mice, and even at an extremely high challenge dose (300 times the lethal adult dose) rBCG-S1PT still induced 50% survival of neonate-immunized mice. Mice immunized with BCG alone experienced a protective effect of 80%, however at a higher challenge dose, this effect was reduced to 50%. Mice immunized with DTP showed no protection (Nascimento et al., 2008).

Mouse Response

• Vaccine Immune Response Type: VO_0000287
• Challenge Protocol: Mice were challenged with wild-type B. pertussis (Chen et al., 1998).
• Efficacy: Mice vaccinated with IEM101 expressing Tcf experienced significant reduction in bacterial colonization of their tracheas (Chen et al., 1998).