VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

Vaccine Detail

Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
Vaccine Information
  • Vaccine Name: Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
  • Target Pathogen: Bordetella bronchiseptica
  • Target Disease: Infectious bronchitis, kennel cough
  • Vaccine Ontology ID: VO_0002801
  • Type: Live, attenuated vaccine
  • Status: Research
  • aroA gene engineering:
    • Type: Gene mutation
    • Description:
    • Detailed Gene Information: Click Here.
  • Preparation: A B. bronchiseptica aroA mutant was constructed by allelic exchange. Introduction of the Km-R cassette into the aroA gene of this strain was confirmed by PCR using aroA-specific primers (aroAfw 5′GGCGTGCAAAGCGGGGCGGACTGGCTGGAG3′ and aroArv 5′ATAATCGGGGAAAGTCTTGCTGACGCAGCC3′) and by Southern blotting and DNA:DNA hybridization using an aroA-specific probe generated by PCR (Stevenson and Roberts, 2002).
  • Immunization Route: intranasal immunization
Host Response

Mouse Response

  • Host Strain: BALB/c
  • Persistence: Wild type B. bronchiseptica could still be detected in lungs up to 56 days post-infection. In contrast, the numbers of BBC18 did not increase following inoculation, but decreased rapidly, and were cleared from the lungs completely by day 6.The nasal cavity samples showed the same trend and were also clear of bacteria after 6 days. The behaviour of the mutant and the wild type strain was mirrored in outbred NIH-S mice. Thus the B. bronchiseptica aroA mutant is highly attenuated (Stevenson and Roberts, 2002).
  • Efficacy: Immunization with GVB120 (B. bronchiseptica aroA mutant expressing FrgC), by either regime, had a major effect on colonization of the lungs, trachea and nasal cavity by wild type B. bronchiseptica BBC17. The effect of immunization on the subsequent colonization with BBC17 was more pronounced in the lower than the upper respiratory tract (Stevenson and Roberts, 2002).
  • Host IgA response
    • Description: High titers of anti-B. bronchiseptica IgA were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click Here.
  • Host IgG response
    • Description: High titers of anti-B. bronchiseptica IgG were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click Here.
  • Host IgM response
    • Description: High titers of anti-B. bronchiseptica IgM were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click Here.
References
Stevenson and Roberts, 2002: Stevenson A, Roberts M. Use of a rationally attenuated Bordetella bronchiseptica as a live mucosal vaccine and vector for heterologous antigens. Vaccine. 2002; 20(17-18); 2325-2335. [PubMed: 12009288].