VO Banner
Search: for Help
Register or Login
Vaccine & Components
Vaccine Mechanisms
Vaccine Literature
Vaccine Design
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Data Exchange
Help & Documents
Contact Us

Bordetella bronchiseptica

Table of Contents
  1. General Information
    1. NCBI Taxonomy ID
    2. Disease
    3. Introduction
    4. Host Ranges and Animal Models
    5. Host Protective Immunity
  2. Vaccine Related Pathogen Genes
    1. aroA (Virmugen)
    2. bscN (Virmugen)
    3. cyaA (Virmugen)
    4. dnt (Virmugen)
    5. trpE (Virmugen)
  3. Vaccine Related Host Genes
    1. Ifng (Interferon gamma)
    2. IgA
    3. IgG
    4. IgM
    5. Il10 (interleukin 10)
  4. Vaccine Information
    1. Bordetella Bronchiseptica Avirulent Live Culture Vaccine (USDA: 1081.00)
    2. Bordetella Bronchiseptica Avirulent Live Culture Vaccine (USDA: 1081.01)
    3. Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
    4. Bordetella bronchiseptica aroA/trpE mutant vaccine
    5. Bordetella bronchiseptica bscN and cyaA double mutant vaccine
    6. Bordetella bronchiseptica dnt mutant vaccine
    7. Canine Adenovirus Type 2-Parainfluenza-Bordetella Bronchiseptica Modified Live Virus & Avirulent Live Culture Vaccine (USDA: 12X1.20)
    8. Canine Parainfluenza-Bordetella Bronchiseptica Modified Live Virus, Avirulent Live Culture Vaccine (USDA: 14M1.20)
    9. Canine Parainfluenza-Bordetella Bronchiseptica Modified Live Virus, Avirulent Live Culture Vaccine (USDA: 14M1.22)
    10. Porcine Rotavirus-Transmissible Gastroenteritis Modified Live Virus Vaccine-Bordetella Bronchiseptica-Clostridium Perfringens Type C-Erysipelothrix Rhusiopathiae-Escherichia Coli-Pasteurella Multocida Bacterin-Toxoid (USDA: 49T9.21)
  5. References
I. General Information
1. NCBI Taxonomy ID:
2. Disease:
Infectious bronchitis, kennel cough
3. Introduction
B. bronchiseptica displays a broad host range which includes mice, rats, guinea pigs, rabbits, cats, dogs, pigs, sheep, horses, and bears. Although human infections have been documented, they are usually associated with a severely compromised host. B. bronchiseptica causes a variety of respiratory diseases such as kennel cough in dogs, atrophic rhinitis in pigs and snuffles in rabbits. Infections established by this subspecies are typically chronic, often asymptomatic, and notoriously difficult to clear even with antibiotic therapy. B. bronchiseptica appears to occupy a position along a continuum with "pathogen" at one end and "commensal" at the other. Its ability to establish long-term asymptomatic infection seems to be an adaptive feature and may represent a balance between immunostimulatory events associated with infection and immunomodulatory events mediated by the bacteria. B. bronchiseptica infection of laboratory animals provides an excellent model system to understand mechanisms that promote persistent bacterial infections (Mattoo et al., 2001).
4. Host Ranges and Animal Models
B. bronchiseptica displays a broad host range which includes mice, rats, guinea pigs, rabbits, cats, dogs, pigs, sheep, horses, and bears. Although human infections have been documented, they are usually associated with a severely compromised host. Animal models for B. bronchiseptica have been developed that reflect both the natural course of infection as well as those that are specifically skewed toward disease. A B. bronchiseptica strain, RB50, has been isolated from the nose of a naturally infected New Zealand White rabbit. Specific pathogen free rabbits inoculated with RB50 become colonized in the nasal cavity, larynx, trachea and lungs. Rat and mouse models have also been developed (Mattoo et al., 2001). B. bronchiseptica has been isolated from dogs, humans, monkeys, cats, rabbits, ferrets, guinea pigs, mice,swine, foxes, rats, hedgehogs, horses, skunks, opossums, raccoons, koala bears, turkeys, and lesser bushbabies (Goodnow, 1980).
5. Host Protective Immunity
Prevention of B. bronchiseptica respiratory tract (lung, tracheal, or nasal turbinate) membrane infections of mammals appears to be dependent upon prevention of attachment to and colonization of host cells by invading bacteria. As there have been few reports of septicemicphase infections, the inhibition of these infections appears to be dependent upon localized activity of humoral agglutinins, antitoxins, or cellular immune factors (Goodnow, 1980).
1. aroA
  • Gene Name : aroA
  • Sequence Strain (Species/Organism) : Bordetella bronchiseptica RB50
  • NCBI Gene ID : 2659145
  • NCBI Protein GI : 33602442
  • Locus Tag : BB3469
  • Genbank Accession : BX640447
  • Protein Accession : NP_890002
  • Taxonomy ID : 257310
  • Gene Starting Position : 3712371
  • Gene Ending Position : 3713699
  • Gene Strand (Orientation) : -
  • Protein Name : 3-phosphoshikimate 1-carboxyvinyltransferase
  • Protein pI : 5.16
  • Protein Weight : 43401.08
  • Protein Length : 442
  • Protein Note : catalyzes the formation of 5-O-(1-carboxyvinyl)-3-phosphoshikimate from phosphoenolpyruvate and 3-phosphoshikimate in tryptophan biosynthesis
  • DNA Sequence : Show Sequence
    >gi|33598993:3712371-3713699 Bordetella bronchiseptica RB50, complete genome
  • Protein Sequence : Show Sequence
    >gi|33602442|ref|NP_890002.1| 3-phosphoshikimate 1-carboxyvinyltransferase [Bordetella bronchiseptica RB50]
  • Molecule Role : Virmugen
  • Molecule Role Annotation : Inactivation of the aroA gene highly attenuates B. bronchiseptica, severely impairing its ability to colonize and survive in the respiratory tract of mice (Stevenson and Roberts, 2002).
  • Related Vaccine(s): Bordetella bronchiseptica aroA mutant vaccine (strain BBS18) , Bordetella bronchiseptica aroA/trpE mutant vaccine
2. bscN
  • Gene Name : bscN
  • Sequence Strain (Species/Organism) : Bordetella bronchiseptica RB50
  • NCBI Gene ID : 2662485
  • NCBI Protein GI : 33600613
  • Locus Tag : BB1628
  • Genbank Accession : BX640441
  • Protein Accession : NP_888173
  • Taxonomy ID : 257310
  • Gene Starting Position : 1729444
  • Gene Ending Position : 1730778
  • Gene Strand (Orientation) : +
  • Protein Name : type III secretion system ATPase
  • Protein pI : 6.86
  • Protein Weight : 43916.31
  • Protein Length : 444
  • Protein Note : ortholog of Bordetella pertussis (BX470248) BP2245
  • DNA Sequence : Show Sequence
    >gi|33598993:1729444-1730778 Bordetella bronchiseptica RB50, complete genome
  • Protein Sequence : Show Sequence
    >gi|33600613|ref|NP_888173.1| type III secretion system ATPase [Bordetella bronchiseptica RB50]
  • Molecule Role : Virmugen
  • Molecule Role Annotation : A double mutant strain of Bordetella Bronchiseptica lacking adenylate cyclase(cyaA gene) and type III secretion(bscN gene) is attenuated and provides protection in mice against 5 × 105 CFU of RB50, the B. Bronchiseptica parent strain (Mann et al., 2007).
  • Related Vaccine(s): Bordetella bronchiseptica bscN and cyaA double mutant vaccine
3. cyaA
  • Gene Name : cyaA
  • Sequence Strain (Species/Organism) : Bordetella bronchiseptica RB50
  • NCBI Gene ID : 2661688
  • NCBI Protein GI : 33599313
  • Locus Tag : BB0324
  • Genbank Accession : BX640437
  • Protein Accession : NP_886873
  • Taxonomy ID : 257310
  • Gene Starting Position : 331399
  • Gene Ending Position : 336621
  • Gene Strand (Orientation) : +
  • Protein Name : bifunctional hemolysin-adenylate cyclase precursor
  • Protein pI : 4.4
  • Protein Weight : 167791.35
  • Protein Length : 1740
  • Protein Note : Also known as cyaortholog of Bordetella pertussis (BX470248) BP0760
  • DNA Sequence : Show Sequence
    >gi|33598993:331399-336621 Bordetella bronchiseptica RB50, complete genome
  • Protein Sequence : Show Sequence
    >gi|33599313|ref|NP_886873.1| bifunctional hemolysin-adenylate cyclase precursor [Bordetella bronchiseptica RB50]
  • Molecule Role : Virmugen
  • Molecule Role Annotation : A double mutant strain of Bordetella Bronchiseptica lacking adenylate cyclase(cyaA gene) and type III secretion(bscN gene) is attenuated and provides protection in mice against 5 × 105 CFU of RB50, the B. Bronchiseptica parent strain (Mann et al., 2007).
  • Related Vaccine(s): Bordetella bronchiseptica bscN and cyaA double mutant vaccine
4. dnt
  • Gene Name : dnt
  • Sequence Strain (Species/Organism) : Bordetella bronchiseptica RB50
  • NCBI Gene ID : 2661538
  • NCBI Protein GI : 33602952
  • Locus Tag : BB3978
  • Genbank Accession : BX640449
  • Protein Accession : NP_890512
  • Taxonomy ID : 257310
  • Gene Starting Position : 4225249
  • Gene Ending Position : 4229643
  • Gene Strand (Orientation) : -
  • Protein Name : dermonecrotic toxin
  • Protein pI : 6.6
  • Protein Weight : 150178.45
  • Protein Length : 1464
  • Protein Note : ortholog of Bordetella pertussis (BX470248) BP3439
  • DNA Sequence : Show Sequence
    >gi|33598993:4225249-4229643 Bordetella bronchiseptica RB50, complete genome
  • Protein Sequence : Show Sequence
    >gi|33602952|ref|NP_890512.1| dermonecrotic toxin [Bordetella bronchiseptica RB50]
  • Molecule Role : Virmugen
  • Molecule Role Annotation : A dnt mutant in Bordetella Bronchiseptica was attenuated and provides protection in guinea pigs against intranasal challenge with strain L3 (Nagano et al., 1988).
  • Related Vaccine(s): Bordetella bronchiseptica dnt mutant vaccine
5. trpE
  • Gene Name : trpE
  • Sequence Strain (Species/Organism) : Bordetella bronchiseptica
  • NCBI Protein GI : 8515760
  • Other Database IDs : CDD:184146
  • Taxonomy ID : 518
  • Gene Strand (Orientation) : ?
  • Protein Name : anthranilate synthase large subunit
  • Protein Length : 506
  • Protein Note : anthranilate synthase component I; Provisional
  • Protein Sequence : Show Sequence
    >gi|8515760|gb|AAF76162.1|AF266751_1 anthranilate synthase large subunit [Bordetella bronchiseptica]
  • Molecule Role : Virmugen
  • Molecule Role Annotation : A trpE mutant, in combination with an aroA mutation, is attenuated in mice and induces significant protection from challenge with wild type B. bronchiseptica (McArthur et al., 2003).
  • Related Vaccine(s): Bordetella bronchiseptica aroA/trpE mutant vaccine
1. Ifng (Interferon gamma)
  • Gene Name : Ifng (Interferon gamma)
  • Sequence Strain (Species/Organism) : Mouse
  • NCBI Gene ID : 15978
  • NCBI Protein GI : 33468859
  • Genbank Accession : NM_008337
  • Protein Accession : NP_032363.1
  • Other Database IDs : MGI:107656; UniProt: P01580
  • Taxonomy ID : 10090
  • Gene Strand (Orientation) : ?
  • DNA Sequence : Show Sequence
    >gi|145966741|ref|NM_008337.3| Mus musculus interferon gamma (Ifng), mRNA
  • Protein Sequence : Show Sequence
    >gi|33468859|ref|NP_032363.1| interferon gamma [Mus musculus]
  • Molecule Role Annotation : IFN-gamma plays a critical role in Th1 type immune response. It is important for protection against infections by various viruses and intracellular bacteria.
  • Additional Molecule Role : Vaximmutor
  • Additional Molecule Role Annotation : The experimental data demonstrated that three time vaccinations with BCG in BALB/c mice induced strong TB Ag-specific IFN-gamma immune responses in splenocytes (Wang et al., 2009).
  • Related Vaccine(s): Bordetella bronchiseptica bscN and cyaA double mutant vaccine
2. IgA
  • Gene Name : IgA
  • Sequence Strain (Species/Organism) : Mus musculus
  • NCBI Gene ID : 238447
  • Genbank Accession : AC160982
  • Taxonomy ID : 10090
  • Chromosome No : 12
  • Gene Starting Position : 8607
  • Gene Ending Position : 12639
  • Gene Strand (Orientation) : -
  • Protein Name : immunoglobulin heavy constant alpha
  • Protein Note : Also known as IgA; Igh-2
  • DNA Sequence : Show Sequence
    >gi|121699722:8607-12639 Mus musculus immunoglobulin heavy chain complex (Igh) on chromosome 12
  • Molecule Role : Vaximmutor
  • Related Vaccine(s): Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
3. IgG
  • Gene Name : IgG
  • Sequence Strain (Species/Organism) : Mus musculus
  • NCBI Gene ID : 16059
  • Genbank Accession : AF010213
  • Taxonomy ID : 10090
  • Chromosome No : 12
  • Gene Starting Position : 881411
  • Gene Ending Position : 914690
  • Gene Strand (Orientation) : +
  • Protein Name : immunoglobulin heavy chain (V7183 family)
  • Protein Note : Also known as IgG; IgH; VI24H; VH7183; B9-scFv; IgVH1(VSG)
  • DNA Sequence : Show Sequence
    >gi|94393741:881411-914690 Mus musculus strain 129/SvJ chromosome 12 unlocalized genomic contig, MGSCv37 alternate locus group 129/SvJ
  • Molecule Role : Vaximmutor
  • Additional Molecule Role : Vaximmutor
  • Related Vaccine(s): Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
4. IgM
  • Gene Name : IgM
  • Sequence Strain (Species/Organism) : Mus musculus
  • NCBI Gene ID : 16019
  • Genbank Accession : AC073553
  • Taxonomy ID : 10090
  • Chromosome No : 12
  • Gene Starting Position : 171229
  • Gene Ending Position : 175133
  • Gene Strand (Orientation) : -
  • Protein Name : immunoglobulin heavy constant mu
  • Protein Note : Also known as Igm; muH; Igh6; Igh-6; Igh-M; AI326478; MGC107036; MGC107507
  • DNA Sequence : Show Sequence
    >gi|121699722:171229-175133 Mus musculus immunoglobulin heavy chain complex (Igh) on chromosome 12
  • Molecule Role : Vaximmutor
  • Related Vaccine(s): Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
5. Il10 (interleukin 10)
  • Gene Name : Il10 (interleukin 10)
  • Sequence Strain (Species/Organism) : Mus musculus
  • NCBI Gene ID : 16153
  • NCBI Protein GI : 6754318
  • Locus Tag : AL513351.1
  • Genbank Accession : NM_010548
  • Protein Accession : NM_010548
  • Other Database IDs : MGI:96537; Ensembl:ENSMUSG00000016529;
  • Taxonomy ID : 10090
  • Gene Strand (Orientation) : ?
  • DNA Sequence : Show Sequence
    >gi|6754317|ref|NM_010548.1| Mus musculus interleukin 10 (Il10), mRNA
  • Protein Sequence : Show Sequence
    >gi|6754318|ref|NP_034678.1| interleukin 10 [Mus musculus]
  • Molecule Role Annotation : IL-10 plays an important role in Th2 type immune response.
  • Related Vaccine(s): Bordetella bronchiseptica bscN and cyaA double mutant vaccine
IV. Vaccine Information
1. Bordetella Bronchiseptica Avirulent Live Culture Vaccine (USDA: 1081.00)
a. Manufacturer:
Wyeth, MVP Laboratories, Inc., Addison Biological Laboratory, Inc.
b. Vaccine Ontology ID:
c. Type:
Live vaccine
d. Status:
e. Location Licensed:
f. Host Species for Licensed Use:
Gray wolf
2. Bordetella Bronchiseptica Avirulent Live Culture Vaccine (USDA: 1081.01)
a. Manufacturer:
Intervet Inc., Novartis Animal Health US, Inc.
b. Vaccine Ontology ID:
c. Type:
Live vaccine
d. Status:
e. Location Licensed:
f. Host Species for Licensed Use:
Gray wolf
3. Bordetella bronchiseptica aroA mutant vaccine (strain BBS18)
a. Vaccine Ontology ID:
b. Type:
Live, attenuated vaccine
c. Status:
d. Gene Engineering of aroA
  • Type: Gene mutation
  • Description:
  • Detailed Gene Information: Click here.
e. Preparation
A B. bronchiseptica aroA mutant was constructed by allelic exchange. Introduction of the Km-R cassette into the aroA gene of this strain was confirmed by PCR using aroA-specific primers (aroAfw 5′GGCGTGCAAAGCGGGGCGGACTGGCTGGAG3′ and aroArv 5′ATAATCGGGGAAAGTCTTGCTGACGCAGCC3′) and by Southern blotting and DNA:DNA hybridization using an aroA-specific probe generated by PCR (Stevenson and Roberts, 2002).
f. Immunization Route
intranasal immunization
g. Mouse Response
  • Host Strain: BALB/c
  • Persistence: Wild type B. bronchiseptica could still be detected in lungs up to 56 days post-infection. In contrast, the numbers of BBC18 did not increase following inoculation, but decreased rapidly, and were cleared from the lungs completely by day 6.The nasal cavity samples showed the same trend and were also clear of bacteria after 6 days. The behaviour of the mutant and the wild type strain was mirrored in outbred NIH-S mice. Thus the B. bronchiseptica aroA mutant is highly attenuated (Stevenson and Roberts, 2002).
  • Efficacy: Immunization with GVB120 (B. bronchiseptica aroA mutant expressing FrgC), by either regime, had a major effect on colonization of the lungs, trachea and nasal cavity by wild type B. bronchiseptica BBC17. The effect of immunization on the subsequent colonization with BBC17 was more pronounced in the lower than the upper respiratory tract (Stevenson and Roberts, 2002).
  • Host Gene Response of IgA
    • Gene Response: High titers of anti-B. bronchiseptica IgA were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click here.
  • Host Gene Response of IgG
    • Gene Response: High titers of anti-B. bronchiseptica IgG were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click here.
  • Host Gene Response of IgM
    • Gene Response: High titers of anti-B. bronchiseptica IgM were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002).
    • Detailed Gene Information: Click here.
4. Bordetella bronchiseptica aroA/trpE mutant vaccine
a. Type:
Live, attenuated vaccine
b. Status:
c. Host Species as Laboratory Animal Model:
d. Gene Engineering of aroA
e. Gene Engineering of trpE
f. Immunization Route
intranasal immunization
g. Mouse Response
  • Persistence: An aroA/trpE mutant is attenuated in mice (McArthur et al., 2003).
  • Efficacy: An aroA/trpE mutant induces significant protection from challenge with wild type B. bronchiseptica (McArthur et al., 2003).
5. Bordetella bronchiseptica bscN and cyaA double mutant vaccine
a. Type:
Live, attenuated vaccine
b. Status:
c. Gene Engineering of bscN
  • Type: Gene mutation
  • Description:
  • Detailed Gene Information: Click here.
d. Gene Engineering of cyaA
  • Type: Gene mutation
  • Description:
  • Detailed Gene Information: Click here.
e. Preparation
An isogenic mutant of RB50 containing an in-frame deletion of the adenylate cyclase toxin gene (cyaA), was constructed with an in-frame deletion of the ATPase (bscN) gene required for type III secretion (Mann et al., 2007).
f. Immunization Route
intranasal immunization
g. Mouse Response
  • Persistence: TLR4def and TNF-α−/− mice were intranasally inoculated with 103, 104, or 105 CFU of RB50 or 105 CFU of AVS in a 50-μl inoculum and observed them for signs of severe disease. WT mice given similar doses of RB50 are able to control the disease and to clear bacteria from the lower respiratory tract (Mann et al., 2007).
  • Efficacy: The nasal cavities of vaccinated TLR4def mice and TNF-α−/− mice contained 10,000-fold fewer CFU than those of control mice. The tracheae and lungs of vaccinated TLR4def mice and TNF-α−/− mice contained <20 CFU, while the same organs of control mice contained approximately 106 and 108 CFU, respectively. These results indicate that low-dose intranasal vaccination with AVS protects susceptible mice from severe infection by a variety of B. bronchiseptica strains (Mann et al., 2007).
  • Host Gene Response of Ifng (Interferon gamma)
    • Gene Response: AVS induces significantly increased IFN-gamma production in mouse splenocytes as compared to naive mice. This increase occurred 28 days after vaccination and after stimulation with heat-killed RB50 (Mann et al., 2007).
    • Detailed Gene Information: Click here.
  • Host Gene Response of Il10 (interleukin 10)
    • Gene Response: AVS induces decreased IL-10 production in mouse splenocytes as compared to inoculation with wild type strain. This decrease occurred 28 days after vaccination and after stimulation with heat-killed RB50. However, IL-10 was significantly upregulated in splenocytes compared to naive mice (Mann et al., 2007).
    • Detailed Gene Information: Click here.
6. Bordetella bronchiseptica dnt mutant vaccine
a. Vaccine Ontology ID:
b. Type:
Live, attenuated vaccine
c. Status:
d. Gene Engineering of dnt
  • Type: Gene mutation
  • Description:
  • Detailed Gene Information: Click here.
e. Preparation
Dom+ Scs+ Hly+ organisms of strain L3 were streaked on two BG-20 agar plates and incubated at 37°C. Ten Dom+ Scs+ Hly- colonies (0.5 to 0.7mm in diameter) grown on each plate were subcultured 10 times under the same culture conditions. Finally, four mutant strains showing the Dom+ Scs+ Hly -phenotype and lacking DNT- producing ability were obtained (Nagano et al., 1988).
f. Immunization Route
intranasal immunization
g. Guinea pig Response
  • Efficacy: Most of the guinea pigs inoculated intranasally or intramuscularly with 2.3 x 107 or 2.3 x 108 viable cells of strain B-42 produced serum agglutination antibodies at 3 week after the inoculation, and most of them survived intranasal challenge with strain L3 (770 x LD50) during observation period (Nagano et al., 1988).
7. Canine Adenovirus Type 2-Parainfluenza-Bordetella Bronchiseptica Modified Live Virus & Avirulent Live Culture Vaccine (USDA: 12X1.20)
a. Manufacturer:
Wyeth, Intervet Inc.
b. Vaccine Ontology ID:
c. Type:
Live vaccine
d. Status:
e. Location Licensed:
f. Host Species for Licensed Use:
Gray wolf
8. Canine Parainfluenza-Bordetella Bronchiseptica Modified Live Virus, Avirulent Live Culture Vaccine (USDA: 14M1.20)
a. Manufacturer:
Boehringer Ingelheim Vetmedica, Inc., Intervet Inc.
b. Vaccine Ontology ID:
c. Type:
Live vaccine
d. Status:
e. Location Licensed:
f. Host Species for Licensed Use:
Gray wolf
9. Canine Parainfluenza-Bordetella Bronchiseptica Modified Live Virus, Avirulent Live Culture Vaccine (USDA: 14M1.22)
a. Manufacturer:
Intervet Inc.
b. Vaccine Ontology ID:
c. Type:
Live vaccine
d. Status:
e. Location Licensed:
f. Host Species for Licensed Use:
Gray wolf
10. Porcine Rotavirus-Transmissible Gastroenteritis Modified Live Virus Vaccine-Bordetella Bronchiseptica-Clostridium Perfringens Type C-Erysipelothrix Rhusiopathiae-Escherichia Coli-Pasteurella Multocida Bacterin-Toxoid (USDA: 49T9.21)
a. Manufacturer:
Intervet Inc.
b. Vaccine Ontology ID:
c. Type:
Live, attenuated vaccine
d. Status:
e. Location Licensed:
f. Host Species for Licensed Use:
V. References
1. Goodnow, 1980: Goodnow RA. Biology of Bordetella bronchiseptica. Microbiological reviews. 1980; 44(4); 722-738. [PubMed: 7010115].
2. Mann et al., 2007: Mann P, Goebel E, Barbarich J, Pilione M, Kennett M, Harvill E. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infection and immunity. 2007; 75(7); 3665-3672. [PubMed: 17452472].
3. Mattoo et al., 2001: Mattoo S, Foreman-Wykert AK, Cotter PA, Miller JF. Mechanisms of Bordetella pathogenesis. Frontiers in bioscience : a journal and virtual library. 2001; 6; E168-186. [PubMed: 11689354].
4. McArthur et al., 2003: McArthur JD, West NP, Cole JN, Jungnitz H, Guzmán CA, Chin J, Lehrbach PR, Djordjevic SP, Walker MJ. An aromatic amino acid auxotrophic mutant of Bordetella bronchiseptica is attenuated and immunogenic in a mouse model of infection. FEMS microbiology letters. 2003; 221(1); 7-16. [PubMed: 12694904].
5. Nagano et al., 1988: Nagano H, Nakai T, Horiguchi Y, Kume K. Isolation and characterization of mutant strains of Bordetella bronchiseptica lacking dermonecrotic toxin-producing ability. Journal of clinical microbiology. 1988; 26(10); 1983-1987. [PubMed: 3182989].
6. Scheiblhofer et al., 2003: Scheiblhofer S, Weiss R, Dürnberger H, Mostböck S, Breitenbach M, Livey I, Thalhamer J. A DNA vaccine encoding the outer surface protein C from Borrelia burgdorferi is able to induce protective immune responses. Microbes and infection / Institut Pasteur. 2003; 5(11); 939-946. [PubMed: 12941385].
7. Stevenson and Roberts, 2002: Stevenson A, Roberts M. Use of a rationally attenuated Bordetella bronchiseptica as a live mucosal vaccine and vector for heterologous antigens. Vaccine. 2002; 20(17-18); 2325-2335. [PubMed: 12009288].