• Vaccine Name: B. pertussis DNA vaccine encoding Prn
• Target Pathogen: Bordetella pertussis
• Target Disease: Whooping Cough
• Vaccine Ontology ID: VO_0011391
• Type: DNA vaccine
• Status: Research
• Antigen: B. pertussis pertactin precursor prn2
• Prn gene engineering:
  • Type: DNA vaccine construction
  • Description: To construct a prn mutant, amplification of the region containing the whole prn2 gene of the CCHMC1 strain was performed using PRN-F GGCACAGGACCGGCGCGTGTTTCGCGCACGACTCT) and PRN-R (CGCGTGGTGCGCCTGAAAGGCGGCGATGCCTTCA) with attB adaptors. The PCR products were cloned into pDONR221 to obtain pDONR-PTXA1 and pDONR-PRN2 by site-specific recombination techniques using the Gateway cloning system (Invitrogen). The regions transferred into the pDONR221 plasmid were sequenced for verification. pDONR-PTXA1 or pDONR-PRN2 was mixed with pABB-CRS2 to obtain pABB-PTXA1 and pABB-PRN2 by using the Gateway cloning system. pABB-PTXA1 or pABB-PRN2 was introduced into E. coli SM10pir and mobilized into the B. pertussis strain Tohama by conjugation (Komatsu et al., 2010).
  • Detailed Gene Information: Click Here.
• DNA vaccine plasmid:
  • DNA vaccine plasmid name:
  • DNA vaccine plasmid VO ID: VO_0005025
• DNA vaccine plasmid:
  • DNA vaccine plasmid name:
  • DNA vaccine plasmid VO ID: VO_0000991
• Immunization Route: Subcutaneous injection

Mouse Response

• Host Strain: BALB/c
• Vaccination Protocol: 3.5-week-old female BALB/c mice (Japan SLC, Hamamatsu) were immunized by two subcutaneous injections of 0.25 SHDs (0.125 ml) over a 2-week interval (Komatsu et al., 2010).
• Challenge Protocol: Two weeks after the second immunization, 50 µl of a suspension containing approximately 6 x 10^6 CFU of B. pertussis was instilled intranasally into mice anesthetized by intraperitoneal injection with pentobarbital sodium (Nembutal; Abbott Laboratories, Abbott Park, IL). Two hours (day 0) or 2, 5, or 8 days after the challenge, the mice were euthanized by pentobarbital injection (Komatsu et al., 2010).
• Efficacy: While the vaccine was effective against all of the B. pertussis strains regardless of the allele expression pattern, the strain expressing ptxA1 and prn2 displayed a survival advantage over the other strains (Komatsu et al., 2010).