VIOLIN Logo
VO Banner
Search: for Help
About
Introduction
Statistics
VIOLIN News
Your VIOLIN
Register or Login
Submission
Tutorial
Vaccine & Components
Vaxquery
Vaxgen
VBLAST
Protegen
VirmugenDB
DNAVaxDB
CanVaxKB
Vaxjo
Vaxvec
Vevax
Huvax
Vaccine Mechanisms
Vaximmutordb
Vaxism
Vaxar
Vaccine Literature
VO-SciMiner
Litesearch
Vaxmesh
Vaxlert
Vaccine Design
Vaxign
Community Efforts
Vaccine Ontology
ICoVax 2012
ICoVax 2013
Advisory Committee
Vaccine Society
Vaxperts
VaxPub
VaxCom
VaxLaw
VaxMedia
VaxMeet
VaxFund
VaxCareer
Data Exchange
V-Utilities
VIOLINML
Help & Documents
Publications
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

OprI

Gene Name OprI
Sequence Strain (Species/Organism) Pseudomonas aeruginosa PAO1
VO ID VO_0012362
NCBI Gene ID 879851
NCBI Protein GI 15598049
Locus Tag PA2853
Genbank Accession AE004091
Protein Accession NP_251543
Taxonomy ID 208964
Gene Starting Position 3206914
Gene Ending Position 3207165
Gene Strand (Orientation) +
Protein Name outer membrane lipoprotein OprI
Protein pI 8.51
Protein Weight 8635.98
Protein Length 83
DNA Sequence
>NC_002516.2:3206914-3207165 Pseudomonas aeruginosa PAO1 chromosome, complete genome
GATGAACAACGTTCTGAAATTCTCTGCTCTGGCTCTGGCTGCTGTTCTGGCCACCGGTTGCAGCAGCCAC
TCCAAAGAAACCGAAGCTCGTCTGACCGCTACCGAAGACGCAGCTGCTCGTGCTCAGGCTCGCGCTGACG
AAGCCTATCGCAAGGCTGACGAAGCTCTGGGCGCTGCTCAGAAAGCTCAGCAGACTGCTGACGAGGCTAA
CGAGCGTGCCCTGCGCATGCTGGAAAAAGCCAGCCGCAAGTA

Protein Sequence
>NP_251543.1 outer membrane lipoprotein OprI [Pseudomonas aeruginosa PAO1]
MNNVLKFSALALAAVLATGCSSHSKETEARLTATEDAAARAQARADEAYRKADEALGAAQKAQQTADEAN
ERALRMLEKASRK

Molecule Role Protective antigen
Molecule Role Annotation Recombinant OprI protein was used to immunize mice, and was found to be protective against a challenge with a four- to fivefold 50% lethal dose of P. aeruginosa (Finke et al., 1990).
Our data showed that mice immunized with OprF/OprI are significantly protected from infection caused by mucoid and nonmucoid strains of P. aeruginosa.(Hassan et al., 2018)
Related Vaccines(s) P. aeruginosa DNA vaccine pGACAG-OprF/OprI , P. aeruginosa DNA vaccine pGACAG-OprF/OprI + pGACAG-PcrV + pGACAG-PilA , P. aeruginosa OprI Protein Vaccine
References